WWW.LIB.KNIGI-X.RU
БЕСПЛАТНАЯ  ИНТЕРНЕТ  БИБЛИОТЕКА - Электронные матриалы
 

Pages:   || 2 |

«2 Оглавление Введение Актуальность темы. Степень разработанности темы исследования Цель работы Задачи исследования. Научная новизна. Теоретическая и практическая значимость работы Методология и ...»

-- [ Страница 1 ] --

2

Оглавление

Введение

Актуальность темы.

Степень разработанности темы исследования

Цель работы

Задачи исследования.

Научная новизна.

Теоретическая и практическая значимость работы

Методология и методы исследования

Положения, выносимые на защиту.

Апробация работы

Публикация результатов исследования.

Благодарности.

Глава 1. Природные условия районов исследования

1.1. Горные места обитания

1.1.1. Хибины

1.1.2. Северо-Западный Кавказ

1.2 Равнинные места обитания

1.2.1 Ленинградская область

1.2.2 Остров Валаам

Глава 2. Биология, морфология, экология и география миксомицетов

2.1. Биология миксомицетов

2.2. Морфология спорокарпов миксомицетов.

2.3. Экология и география миксомицетов

Глава 3. История изучения нивальных миксомицетов

Глава 4. Материалы и методы

4.1. Методы сбора и обработки материала

4.2. Молекулярные методы таксономического определения

4.3. Математические методы

4.4. Исследование фенологии спороношения нивальных миксомицетов

4.5. Культивирование миксамеб

Глава 5. Аннотированный список нивальных миксомицетов

Глава 6. Сравнительный анализ видового богатства и таксономической структуры сообществ нивальных миксомицетов.

6.1. Видовое богатство и разнообразие сообществ нивальных миксомицетов в районах исследованния

6.2. Таксономическая структура сообществ нивальных миксомицетов в районах исследования

6.3. Таксономическая структура сообществ нивальных миксомицетов в различных типах растительности

6.4. Сравнительный анализ сообществ нивальных миксомицетов исследованных районов.

Глава 7. Субстратные комплексы нивальных миксомицетов

7.1. Субстратные комплексы нивальных мксомицетов изученных территорий...............82 

7.2. Таксономическая структура сообществ нивальных миксомицетов на разных типах субстрата

Глава 8. Роль климатических факторов в фенологии спороношения нивальных миксомицетов

8.1. Пространственно-временная динамика образования плодовых тел нивальных миксомицетов

8.2. Снежный покров и температурный режим.

8.3. Механизмы образования плодовых тел

8.4. Миксамебы нивальных миксомицетов как компоненты микробного подснежного сообщества

8.5. Влияние температурного режима на жизнеспособность и активность миксамеб.....97 Заключение

Выводы

Список литературы

Приложение 1

Приложение 2

Приложение 3

 

ВВЕДЕНИЕ

Актуальность темы Изучение разнообразия грибов и грибоподобных протистов значительно отстает от аналогичных исследований растений и животных. Ввиду этого для отечественной микологии одной из самых важных задач является инвентаризация их видового состава. Также проведение синэкологических и биогеографических исследований затрудняется особенностями биологии многих групп грибов и микроорганизмов. При этом к последним относят организмы, размер которых не превышает 10 мкм [54]. В отношении биогеографии микроорганизмов на данный момент существует два подхода: модель космополитизма [51, 52, 53, 54] и широко обсуждаемая в последнее время модель умеренного эндемизма [61, 62, 63].

Вторая модель рассматривается в контексте постулата "все есть везде, но среда отбирает" (EiE гипотеза) [64, 65, 118]. Незначительная генетическая дифференциация или ее полное отсутствие среди удаленных друг от друга популяций, рассматривается как аргумент для подтверждения космополитной модели их распространения. Однако накапливающиеся данные свидетельствуют, что одни микроорганизмы распространены очень широко, а другие являются эндемиками с очень ограниченным распространением [62]. При таком противоречии можно предположить, что многие так называемые космополитные виды на самом деле представлены группами криптических видов с ограниченным распространением. Решение этих вопросов возможно только на основе комплексного подхода, включающего анализ морфологической и генетической изменчивости среди популяций, а также особенностей их экологии. Очевидно, такие работы могут успешно проводиться на группах микроорганизмов, относительно легко выявляющихся в природе, поддающихся культивированию в лаборатории и обладающих выраженными морфологическими и генетическими маркерами.

Одна из таких групп – плазмодиальные миксомицеты (Myxomycetes = Myxogastria). В нее входят около 1000 видов грибообразных наземных спорообразующих протистов, объединенных в 5 порядков: Echinosteliales, Trichiales, Stemonitales, Physarales и Liceales [17, 18, 117, 202]. В последние годы их представители стали модельными объектами для многочисленных цитологических, биохимических, биофизических и генетических исследований, лежащих в основе эволюционных и филогенетических построений [15].

По последним данным, миксомицеты являются наиболее многочисленной группой почвенных амебоидных протистов [220, 229], влияющих на состав и численность почвенных микроорганизмов [50, 167] и поддерживающих баланс между бактериальным и грибным процессом разложения органического вещества [113]. В их жизненном цикле сочетаются как стадии микроскопических миксамеб и зооспор, выполняющих трофическую функцию, так и макроскопических, часто хорошо заметных в природе на различных субстратах, плодовых тел (спорокарпов), содержащих споры и сохраняющихся в виде гербарных образцов. Именно на морфологических признаках спорокарпов основана вся традиционная систематика и классификация миксомицетов. Лишь в последнее десятилетие были опубликованы первые молекулярно-филогенетические исследования [25, 49, 55, 56, 58, 59, 60, 156]. Тем не менее, таксономическая система миксомицетов на разных уровнях все еще очень нестабильна [59].

Одной из уникальных экологических групп миксомицетов являются нивальные виды (около 70 таксонов, преимущественно из порядков Physarales и Stemonitales). Все они формируют хорошо заметные невооруженным глазом спорокарпы весной на границе тающего снега или даже под снегом. Однако учитывая эфемерность фенологии их спороношения, данные виды редко попадают в сборы даже опытных микологов. Большинство морфологических видов нивальных миксомицетов рассматривается как космополиты. Это утверждение основывается на очень небольшом числе специальных исследований и требует аргументированной проверки. Крайне мало известно об особенностях их биологии, видовом и экологическом разнообразии. До последнего времени считалось, что они обитают только в субальпийском или альпийском поясах высокогорий. В последнее время их присутствие в лесах равнинных таежных ландшафтов подтверждается спорадическими находками спорокарпов [15], а также результатами предварительных исследований образцов почв методами метагеномики [81].

Степень разработанности темы исследования Несмотря на многолетнюю историю изучения миксомицетов в России [23] нивальные миксомицеты до сих пор специально не изучались [47, 48, 157, 198]. К началу наших исследований в нашей стране было зарегистрировано лишь 10 видов из Ленинградской области [15] и Хибин [163, 164].

Нами впервые планировалось провести комплексные исследования морфологического, генетического и экологического разнообразия популяций нивальных миксомицетов из удаленных друг от друга горных систем и равнинных ландшафтов России. В ходе выполнения исследования нами применялись методы и подходы, хорошо зарекомендовавшие себя в ходе предыдущих работ по изучению видового разнообразия миксомицетов [2, 3, 8, 11, 12, 13, 14, 16, 17].

Цель работы – получить данные о видовом и экологическом разнообразии нивальных миксомицетов из удаленных друг от друга горных систем и равнинных ландшафтов России.

Задачи исследования:

1. Выявить видовой состав нивальных миксомицетов горных ландшафтов России на примере Тебердинского государственного природного биосферного заповедника (Северо-Западный Кавказ) и Хибин (Кольский п-ов), а также равнинных ландшафтов на примере окрестностей пос. Васкелово (Ленинградская область) и о. Валаам (Карелия).

2. Сравнить особенности таксономической структуры сообществ нивальных миксомицетов исследуемых территорий.

3. Проследить дифференциацию таксономической структуры сообществ нивальных миксомицетов различных местообитаний в пределах горных и равнинных типов растительных сообществ.

4. Оценить интенсивность спороношения нивальных миксомицетов на разных типах субстрата.

5. Выявить особенности фенологии образования плодовых тел нивальных миксомицетов на примере Тебердинского государственного природного биосферного заповедника (СевероЗападный Кавказ).

Настоящая работа выполнена в Лаборатории систематики и географии грибов Ботанического института им. В. Л. Комарова Российской академии наук под руководством ведущего научного сотрудника лаборатории, доктора биологических наук, Юрия Капитоновича Новожилова.

Научная новизна 1. Впервые нами были проведены планомерные исследования по инвентаризации нивальных миксомицетов некоторых горных и равнинных ландшафтов Кавказ, Хибины, Ленинградская область, Карелия), а также (Северо-Западный проанализировано их видовое и экологическое разнообразие в основных высотных поясах изученных горных районов.

2. Впервые проведен анализ видовой структуры нивальных миксомицетов на различных субстратах (наземный опад и надземные части живых растений).

3. Впервые для районов исследования было проведено картирование распространения нивальных миксомицетов с применением геоинформационных технологий на основе созданной базы данных.

Выявлены новые, ранее неизвестные типы местообитаний нивальных 4.

миксомицетов, например, сосняк-черничник в таежной зоне, а также арктическая горная тундра в Арктике.

5. Впервые на основе многолетних наблюдений с использованием климатических датчиков дана оценка влияния некоторых климатических факторов на интенсивность спорообразования нивальных миксомицетов.

Впервые установлены ранее неизвестные факты о генетическом и 6.

морфологическом разнообразии близкородственных видов нивальных миксомицетов родов и На основании анализа Diderma, Lamproderma, Meriderma Physarum. 144 последовательностей гена 18S рРНК 35 таксонов, показано, что они представлены 58 генетическими типами.

Теоретическая и практическая значимость работы Изучение видового состава, таксономической структуры и региональных экологических особенностей нивальных миксомицетов в горных и равнинных ландшафтах России вносит вклад в инвентаризацию и сохранение биоразнообразия этой группы, а также в изучение проблем биоразнообразия, экологии и биогеографии микроорганизмов.

В результате исследования получены и обобщены сведения о таксономическом составе нивальных миксомицетов России. Подготовлен конспект, включающий 55 таксонов видового и внутривидового уровней из 9 родов, относящихся к 5 семействам и 3 порядкам, из них 39 таксонов обнаружены на территории России впервые. Конспект содержит текстовую и оригинальную иллюстративную информацию о разнообразии нивальных миксомицетов России, в том числе данные о редких видах, известных в мире лишь по единичным находкам.

Полученные данные будут использованы для подготовки следующего издания «Определителя миксомицетов России» и микофлористических сводок для ряда регионов России и других стран.

В ходе исследований гербарий миксомицетов Ботанического института РАН (LE) пополнился 1422 образцами, из которых около 1000 собрано автором. Этот материал использовался для выполнения программы «Живая природа», грантов РФФИ (13-04-00839A, 12-04-33018 мол_а_вед, 14-04-10106-К) и тем государственного заказа: Биоразнообразие и пространственная структура сообществ грибов и миксомицетов в природных и антропогенных экосистемах 01201255604, Определитель грибов России (серийное издание) 01201255602, Гербарные фонды БИН РАН (история, сохранение, изучение и пополнение) Лаборатории систематики и географии грибов БИН РАН.

Методология и методы исследования В ходе выполнения исследования нами применялись методы и подходы, хорошо зарекомендовавшие себя в ходе предыдущих работ по изучению видового разнообразия миксомицетов:

– методы сбора и обработки материала (подготовка гербарных образцов),

– морфологические методы, связанные с приготовлением и микроскопическим исследованием полупостоянных препаратов и препаратов для электронной микроскопии,

– методы молекулярной биологии (выделение ДНК, ПЦР, гель-электрофорез, секвенирование ДНК)

– математические методы обработки статистических данных (канонический анализ соответствий, модифицированный коэффициент сходства Чао-Серенсена, алгоритм генерации псевдовыборок, расчет коэффициента Тьюринга, индекса Шэннона, индекса Пиелоу, индекса Симпсона)

– метод культивирования миксамеб на голодном агаре.

Впервые для анализа влияния климатических факторов на фенологию спороношения нивальных миксомицетов применялся мониторинг некоторых климатических параметров микроместообитаний с помощью портативных датчиков (логгеров).

Положения, выносимые на защиту:

1. Данная работа в полной мере представляет таксономический состав нивальных миксомицетов на территории Северо-запада России и Северо-Западного Кавказа.

2. Видовой состав и встречаемость отдельных видов нивальных миксомицетов меняется в пределах высотно-зонального градиента, что соотносится с моделью умеренного эндемизма..

3. Существует разрыв между морфологическим и генетическим разнообразием нивальных миксомицетов, который отражает скрытое разнообразие, требующее филогенетического подхода в ревизии некоторых проблемных родов данной группы.

4. Интенсивность образования плодовых тел нивальных миксомицетов зависит от сочетания выявленного нами комплекса климатических факторов, создаваемых не только весной в период таяния снега, но и на протяжении всего года.

Апробация работы Результаты исследования были представлены на заседаниях Лаборатории систематики и географии грибов БИН РАН, а также на международных конференциях: II (X) Международной ботанической конференции молодых ученых в СанктПетербурге (Санкт-Петербург, Россия, 2012), Международной конференции молодых ученых «Актуальные проблемы ботаники и экологии» (Щолкино, Украина, 2013) и Всероссийской конференции с международным участием «Биоразнообразие и экология грибов и грибоподобных организмов Северной Евразии» (Екатеринбург, Россия, 2015).

Публикации результатов исследования По теме диссертации опубликовано 4 научные статьи в ведущих микологических журналах из списка изданий, рекомендованных ВАК РФ.

Благодарности Автор выражает особую благодарность своему научному руководителю, д.б.н., проф. Юрию Капитоновичу Новожилову, а также заведующему Лабораторией систематики и географии грибов д.б.н., проф. Александру Елисеевичу Коваленко; к.б.н., м.н.с. Вере Федоровне Малышевой, к.б.н., м.н.с. Екатерине Федоровне Малышевой, к.б.н.

Михаилу Вадимовичу Окуню, к.б.н., с.н.с. Ирине Юрьевне Кирцидели, к.б.н., м.н.с.

Людмиле Владимировне Гагариной, к.б.н., асс. Василию Владимировичу Златогурскому (СПбГУ) и м.б.н. Юте Юрьевне Тамберг (СПбГУ) за поддержку, обсуждения и ценные комментарии. Отдельная благодарность магистранту Олегу Николаевичу Щепину (СПбГУ) за помощь в проведении культуральных экспериментов и проф. Мартину Шниттлеру (Институт экологии и ландшафтного дизайна Эрнста Морица, Грайфсвальд, Германия) за совместные исследования и помощь в работе.

ГЛАВА 1. ПРИРОДНЫЕ УСЛОВИЯ РАЙОНОВ ИССЛЕДОВАНИЯ

Среди исследованных мест обитания можно выделить две основные группы: горные и равнинные. Ниже даны описания регионов, где проводились исследования, с акцентом на наиболее важные для сообществ нивальных миксомицетов природно-климатические особенности. Географические характеристики отдельных пробных площадей (ПП) из каждого местообитания приведены в Приложении 1.

1.1. Горные места обитания 1.1.1. Хибины Горный массив Хибины (Рис. 1 А) представляет собой самую восточную часть Скандинавских гор и расположен в центральной части Кольского полуострова на северозападе Европейской России в Мурманской области (67°36' – 67°55' с. ш., 33°23' – 34°12' в. д.).

ПП (1 – 76) в районе исследования закладывались в южной части пяти горных долин в окрестностях Полярно-альпийского ботанического сада-института им. Н. А. Аврорина Кольского научного центра РАН (ПАБСИ) (67°38' с. ш., 33°37' в. д.), расположенного в 15 км северо-восточнее города Апатиты (Рис. 1 Б).

Рис. 1. А Географическое положение Хибин в северо-западной части Европейской России (указано стрелкой). Б Местоположение изученных пробных площадей в пределах горного массива: 1, 2, 11, 18–19, 34–36, 66 на г. Вудъявр; 3–7, 59–65, 67 на г. Кукисвумчорр; 8–10 в долине р. Поачвумйок; 12–17, 20–26, 68 на г. Тахтарпор.; 27–33 на г. Северный Ворткейявр;

37–49 в долине р. Вудъяврйок; 50–58 на г. Поачвумчорр. Обозначения: ПАБСИ – Полярноальпийский ботанический сад-институт. Источник: Google Earth (7.1.2.2014), с изменениями.

Массив сформирован большим щелочным интрузивным телом и занимает около 1327 км2 [76]. Уплощенные горные вершины, не превышающие в среднем 1000–1100 м над уровнем моря (н.у.м.), перемежаются глубокими долинами (300–400 м н.у.м.). Самыми высокими точками являются горы Юдычвумчорр (1200 м) и Ферсмана (1208 м). В Плейстоцене Хибины почти полностью были покрыты ледником, чье таяние сформировало современное разнообразие рельефа с обилием мореновых озер, мореновых впадин, валунов и протоков.

Крупных рек на территории горного массива нет, самым крупным озером является озеро плотинного типа Большой Вудъявр.

Климат Хибин можно сравнить с климатом Норвегии в ее океанической части [232], поскольку расположение в высоких широтах (выше Полярного круга) смягчается влиянием Гольфстрима и характеризуется как переходный от океанического к субарктическому.

Средние температуры колеблются от – 15° C в январе до 15° C в июле. В глубоких долинах значения зимних температур могут нетипично подниматься до 9° C. В июне же температурная инверсия может приводить к опусканию ниже – 5° C. Снежный покров начинает стаивать в долинах обычно в первой половине июня, но способен локально задерживаться на северных склонах до августа. Влажность воздуха относительно высокая, среднегодовое количество осадков не превышает 500–1100 мм. Часто образуются туманы, особенно весной и летом.

На территории преобладают богатые гумусом иллювиально-подзолистые почвы [5].

С высотой состав растительности меняется от таежного типа в долинах (ПП 71-76) до арктической горной тундры на вершинах гор (Рис. 2). Однако, несмотря на интенсивные исследования во всех типах растительности, нивальные миксомицеты были зарегистрированы только в субальпийском березово-рябиновом криволесье (Рис. 2 А, Б) и горной тундре (Рис. 2 В, Г). Следующие описания этих типов растительности приводятся по монографии А. В. Домбровской [5]. Здесь и далее названия сосудистых растений даны в соответствии с монографией С.К. Черепанова [21].

БС (ПП 1, 2, 4–11, 14, 16, 17, 20, 27–30, 33, 35–42, 46–53, 55–62, 65–70) – березовое субальпийское криволесье, преобладающее на небольших высотах между 300 и 600 м н.у.м., преимущественно на южных и западных горных склонах. Верхний ярус образован видамидоминантами: Betula czerepanovii N.I. Orlova и Sorbus gorodkovii Pojark. Средний ярус сформирован карликовыми елями характерной флагообразной формы, а также осиной, ивой, можжевельником и карликовой березой. Нижний ярус представлен кустарниковыми зарослями Empetrum hermaphroditum Lange ex Hagerup, Vaccinium uliginosum L., Phyllodoce caerulea L. Bab. Средняя годовая температура на 6,7° C выше, чем в альпийской тундре.

Абсолютные значения температур варьируют от tmin=–52° C в феврале до tmax=28° C в августе.

Рис. 2. А, Б – березовое субальпийское криволесье. В, Г – альпийская тундра.

АТ (ПП 3, 12, 13, 15, 18, 19, 21–26, 31, 32, 34, 43–45, 54, 63, 64) – альпийская тундра, преобладающая на высотах между 450–1000 м н.у.м., на склонах любой экспозиции и на уплощенных горных вершинах. Здесь доминируют верескоцветные кустарнички (Empetrum, Vaccinium, Calluna, Arctostaphylos) или сообщества лишайников и мхов, формирующиеся на аллювиальных почвах и вокруг скальных обнажений. Из-за частой климатической инверсии в тундре январь и февраль теплее, чем в нижележащих долинах, а май и июнь гораздо холоднее. Абсолютные значения температур варьируют от tmin = –34° C в феврале до tmax= 25° C в августе. Относительная влажность выше, чем в нижележащих долинах, и в течение почти всего года достигает 100 %. Среднегодовое количество осадков часто превышает 900 мм. Около 60 % годовых осадков (не менее 250 мм) выпадает в виде снега и тем самым обеспечивается благоприятный для сообществ нивальных миксомицетов толстый снежный покров. Часто в горах случаются лавины (до 20 лавинных дней в году).

1.1.2. Северо-Западный Кавказ Северо-Западный Кавказ расположен к западу от меридиональной лини, проходящей через гору Эльбрус (43°2045 с. ш. 42°2655 в. д.). Восточная часть Северо-Западного Кавказа характеризуется типичным альпийским обликом с многочисленными ледниками и высокогорными формами рельефа. ПП (77-99) в районе исследования закладывались в пределах Тебердинского государственного природного биосферного заповедника, расположенного на северных склонах Большого Кавказа (Рис. 3 А) в верхней части долины р. Теберда.

Заповедник занимает около 850 км2 и представлен двумя частями, Тебердой (координаты научной станции: 43°27' с. ш., 41°44' в. д.) и Архызом (координаты научной станции: 43°32' с. ш., 41°10' в.д.). Вся территория представляет собой высокогорный район с перепадом высот от 1260 до 4047 м н.у.м., из них 86 % площади расположено выше 2000 м н.у.м. Самой высокой точкой является гора Домбай-Ульген (4046 м н.у.м.). Изученные ПП расположены на северных склонах гор Домбай и Малая Хатипара (Рис. 3 Б, В).

Водный режим Северо-Западного Кавказа имеет характерные для горных местностей черты. Значительная часть воды сосредоточена в ледниках. Реки имеют большую скорость течения, и резкие изменения уровня воды в зависимости от времени года. В начале весны обильное таяние снегов приводит к половодьям, спадающим к концу лета. Крупнейшие реки Кубань, Теберда. Озера кресловинные или каровые, в западной части почти всегда вулканического происхождения.

Климат умеренный, суббореальный. Средний годовой перепад температур и осадков в Тебердинском заповеднике варьирует от 6,7° C и 782 мм (1313 м н.у.м.) до 4,0° C и 1797 мм (2042 м н.у.м.) [46]. В долине р. Теберды максимальное количество осадков наблюдается в июне (79,8 мм), минимум в феврале (36,4 мм). Абсолютные значения температур варьируют от tmin = –2,4° C в январе до tmax= 16° C в июле. Средняя продолжительность безморозного периода составляет 126 дней, вегетативный период длится с мая по сентябрь [169]. Весной погода неустойчива, часты заморозки и снег выпадает даже в мае [46].

На открытых для ветра склонах г. Малая Хатипара были хорошо изучены перепады почвенных температур. Так, почвы лишайниковых пустошей на вершине горы самые теплые в июле (12,8° C) из-за того, что снег рано сходит ввиду избыточной солнечной радиации, а самые холодные в феврале (– 3,6° C) из-за тонкого снежного покрова. На более низких высотах перепады температур в почве менее выражены в связи с продолжительным накоплением снега и поздним весенним таянием, что создает оптимальные условия для развития сообществ нивальных миксомицетов [115].

Рис. 3. А Географическое положение Тебердинского государственного биосферного заповедника в переделах Главного Кавказского хребта (стрелка). Б ПП на г. Домбай (77 в долине р. Гуначхир; 78, 84, 85 на ЮЗ склоне вершины Мусса-Ахитара) и на северном склоне г. Малая Хатипара (79–99). В Детализованное расположение ПП 79–83, 86–99 на высотах между 1700–2920 м н.у.м. Источник: Microsoft Encarta Reference Library 2002 и Google Earth (6.1.0.5001), с изменениями.

На территории исследования преобладают каменистые глинистые сланцевые почвы.

Верхний почвенный горизонт кислый (4,7–5,6 pH) и содержит до 20 % гумуса с высоким содержанием крупных фрагментов растительных остатков, что обусловлено низкой бактериальной активностью [168].

Пояса растительных сообществ значительно изменяются с высотой от широколиственных буковых и хвойных лесов в долинах рек (ПП 94, 95) до бедных лишайниковых сообществ, формирующихся на тонком первичном слое почвы на вершинах гор, свободных от ледников. Среди всех изученных растительных сообществ нивальные миксомицеты, были зарегистрированы только в трех. Их краткое описание дается в соответствии с классификацией В.Г. Онипченко [168, 169].

БСК (ПП: 77, 79, 82, 92, 99) березовое субальпийское криволесье. В верхнем ярусе доминирует Betula litwinowii Doluch., подлесок образован преимущественно Rhododendron caucasicum Pall. (Рис. 4 А). Это сообщество наиболее часто встречается на северных склонах на высотах между 1800–2420 м н.у.м. (Рис. 4 Б). Подлесок образован типичными растениями бореальных лесов (например, Dicranum scoparium Hedw., Vaccinum myrtillus L., V. vitis-idaea L.), а также растениями субальпийских и высокотравных лугов (например, Senecio nemorensis L., Pulmonaria mollis Wulfen ex Hornem.). Почвы имеют хорошо выраженный гумусовый слой, но низкое содержание кальция и магния. Высокий снежный покров в течение зимы способен защищать стволы деревьев и кустарников, но выступающие над снегом ветви часто искривляются или разрушаются.

АЛПа (ПП: 80, 81, 84–86) субальпийский луг. Этот тип распространен на крутых склонах с бедными кислыми почвами, покрытыми распростертыми сообществами Rhododendron caucasicum, Juniperus communis L. и карликовыми формами Betula litwinowii в верхнем ярусе и Vaccinum vitis-idaea, V. myrtillus и Empetrum nigrum L. в нижнем. Тип преобладает на высотах между 24502600 м н.у.м. (Рис. 4 В, Г, Д).

АЛПб (ПП: 78, 83, 87–90, 93, 96–98) альпийский луг. Этот тип встречается на пологих открытых склонах и преобладает на высотах между 26002950 м н.у.м. В сообществе доминируют альпийские травы и злаки: Festuca varia s. str (Kliffman), Viola altaica Ker Gawl., Carex umbrosa Host, Geranium gymnocaulon DC. и Pulsatilla aurea (Sommier & Levier) Juz. (Рис. 4 Е). Такие сообщества приурочены к местам, где долго сохраняется снежный покров в течение года, и характеризуются избыточным увлажнением в течение всего вегетационного периода.

Рис. 4. А, Б – березовое субальпийское криволесье. В, Г, Д – субальпийский луг. Е, – альпийский луг.

1.2. Равнинные места обитания 1.2.1. Ленинградская область Ленинградская область расположена на Северо-Западе Европейской части России (60°3' с. ш., 31°45' в. д.) и окружена Финским заливом Балтийского моря на Западе, Ладожским и Онежским озерами на Востоке, граничит с Финляндией, республикой Карелией, Вологодской, Новгородской и Псковской областями Российской Федерации (Рис.

5 А). Ее площадь составляет около 85 900 км2. Исследование сообществ нивальных миксомицетов проводилось в окрестностях пос. Васкелово (60°22'16'' с. ш., 30°22'14'' в. д.), расположенного в северо-западной части Ленинградской области, в 51 км севернее СанктПетербурга. ПП были заложены рядом с озером Гупуярви (Рис. 5 Б).

Рис. 5. А Географическое положение поселка Васкелово (ВС) и Валаама (ВЛ) в пределах Северо-запада Российской Федерации (обозначены стрелками); звездочка обозначает положение Санкт-Петербурга; БМ – Балтийское море. Б Пробные площади в окрестностях поселка Васкелово. В – ельник-черничник. Г Пробные площади в пределах о.

Валаам. Д – сосняк-черничник. Источник: Google Earth (7.1.2.2014), с изменениями.

Рельеф преимущественно представлен низинами Выборгской, (Приморской, Приозерской, Приладожской, Плюсской, Волховской, Свирской, Тихвинской и Лужской). На территории области имеются также небольшие возвышенности (Тихвинская, Лодейнопольская, Лемболовская, Ижорская, Вепсовская,), достигающие 300 м н.у.м., со следами ледниковой активности.

Климат является переходным от морского к континентальному с мягкой зимой и прохладным летом [4]. Средняя температура января –7 –11° С, июля 15 – 17,5° С. Область располагается в зоне избыточного увлажнения, среднегодовое количество осадков составляет 550–850 мм. Период снежного покрова длится 120–160 дней. Продолжительность вегетационного периода составляет 150–170 дней.

Почти вся территория области кроме юго-восточной имеет хорошо развитую густую речную сеть, общая протяженность которой около 50 000 км. Много озер ледникового происхождения, в том числе и крупнейшее в Европе Ладожское озеро. Значительная часть территории покрыта болотами.

Преобладают избыточно увлажненные подзолистые и болотистые почвы с повышенной кислотностью. Последний тип относится к застойным и формируется при плохом дренаже атмосферных или грунтовых вод. Основными почвообразующими породами являются глины и суглинки, а также пески и торф.

Леса покрывают 54 % незаселенной площади, преобладают сосновые, еловые, березовые и осиновые леса. Остальное пространство покрыто водными угодьями, болотами, пашнями и лугами. В пределах изученной территории сообщества нивальных миксомицетов были обнаружены только в двух типах растительных сообществ (Рис. 5). Следующее описание этих типов основано на классификации А.В. Дарийского [4].

ЕЧ (ПП 100–106) – ельник-черничник. Это наиболее распространенный тип растительности в данном районе исследования. Доминирующим видом является Picea abies (L.) Karst., что делает это местообитание мало освещенным, мало проветриваемым и закрытым. Почвы сильноподзолистые с выраженным верхним слоем. Подрост сформирован сосной, березой, осиной и рябиной. Нижний ярус представлен преимущественно верескоцветными видами (Vaccinium myrtillus, V. vitis-idaea, Phyllodoce caerulea L. Bab.), а также мхами и печеночниками. Снежный покров сохраняется дольше, чем в соснякечерничнике, вплоть до первой декады мая.

1.2.2. Остров Валаам Валаамский архипелаг (61°22'0'' с. ш., 30°56'0'' в. д.) располагается в пределах республики Карелия, в северной части Ладожского озера [10]. Площадь архипелага составляет 36 км и представлена более чем 50 островами. ПП в районе исследования были заложены на самом большом из них – о. Валааме (61°23'21'' с. ш., 30°56'42'' в. д.), площадью 27,8 км (Рис. 5 А, Г).

Остров имеет тектоническое происхождение, связанное с поднятием крупного интрузивного тела. Рельеф представляет собой отдельные скальные гряды и крутые приподнятые массивы, пересеченные в местах трещин понижениями (лощинами, заливами, озерами). Береговая линия сильно изрезана, вследствие чего имеется большое количество бухт и мелких заливов. Высота меняется в интервале от 5,1 до 58,3 м. н.у.м.

Водная система хорошо развита, имеется 11 озер, из которых самые крупные: Сисяярви (0,8 км2) и Лещевое (0,24 км2). Ряд мелких озер подвергается заболачиванию. Отмечено, что минерализация и содержание органического вещества озер острова выше, чем в прилежащей материковой Карелии.

Климат сходен с климатом Ленинградской области, но еще более мягок из-за влияния Ладожского озера. Это выражается в более сглаженных перепадах суточных и среднегодовых температур по сравнению с прилежащими континентальными областями, уменьшении продолжительности присутствия снежного покрова и частых туманах. Средняя годовая температура составляет 3,6 °C, средняя температура самого холодного месяца (февраля) –8,6° C, самого теплого (июля) 16,7° C. Средняя относительная влажность достигает максимальных значений по Карелии (81–83 %). Район характеризуется частыми сильными ветрами (более 15 м/с).

Как и в Ленинградской области, здесь преобладают бедные подзолистые и болотистые почвы. Всего на острове выделяют до 14 типов почв, из которых также следует указать примитивные, подзолисто-болотные и дерново-глеевые.

Территория архипелага относится к среднетаежной подзоне тайги. На острове преобладают хвойные леса, из них около 65 % сосняки. Сообщества нивальных миксомицетов были обнаружены только в двух типах растительности.

ЕЧ (ПП 107-110, 113) – описание для этого типа растительности приводится выше (Раздел 1.2.1).

С Ч (ПП 111, 112) – сосняк-черничник. Это светлое, открытое и продуваемое ветрами растительное сообщество, где в верхнем ярусе доминирует Pinus sylvestris L. Почвы слабоподзолистые, плохо удерживающие влагу. Нижний ярус беден и сформирован преимущественно зарослями V. myrtillus. Снежный покров весной сохраняется недолго по сравнению с ельником-черничником.

ГЛАВА БИОЛОГИЯ, МОРФОЛОГИЯ, ЭКОЛОГИЯ И ГЕОГРАФИЯ

2.

МИКСОМИЦЕТОВ

2.1. Биология миксомицетов Плазмодиальные миксомицеты имеют сложный жизненный цикл, который разделяется на две основные стадии: вегетативную и генеративную (Рис. 6). Вегетативная стадия представлена многоядерным плазмодием, амебоидной одноядерной клеткой (миксамебой) или одноядерной клеткой со жгутиками (зооспорой) и выполняет трофическую и локомоторную функции. Генеративная стадия представляет собой плодовое тело (спорокарп), содержащее споры, и служит для рассеивания пропагул.

Жизненный цикл начинается, когда из зрелой споры, обычно с одним гаплоидным ядром, при благоприятных условиях через особую пору или щель в споровой оболочке выходит гаплоидная одноядерная клетка. В случае дефицита влаги в окружающей среде из споры высвобождается миксамеба, сразу готовая к питанию. В присутствии капельножидкой воды из споры выходит подвижная гетероконтная зооспора с двумя передними жгутиками. При изменении влажности среды зооспоры и миксамебы способны переходить друг в друга. Оба типа клеток способны увеличивать свою численность путем митотических делений, при этом у зооспор перед началом каждого деления происходит разборка жгутиков.

При наступлении неблагоприятных условий зооспоры и миксамебы покрываются плотной оболочкой и формируют сферическую покоящуюся стадию микроцисты [84, 159, 167].

Рис. 6 Жизненный цикл миксомицетов по [201] с изменениями.

Через некоторое время и миксамебы, и зооспоры приобретают физиологическую компетентность, то есть способность к попарному слиянию [40]. Каждому виду требуется определенный период времени после выхода из спор, составляющий, например, у Perichaena vermicularis (Schwein.) Rostaf. 12–18, а у Didymium iridis (Ditmar) Fr. 10–12 часов [185, 186, 187].

Непосредственно после плазмогамии происходит кариогамия [167, 185]. Возникшая таким образом диплоидная клетка дает начало плазмодиальной стадии жизненного цикла. У некоторых видов, например, у Physarum polycephalum Schwein., описаны случаи развития плазмодиев без слияния двух клеток [27]. Ядра плазмодиев проходят через серию митозов, которые приводят лишь к увеличению их количества в цитоплазме, цитокинеза при этом не происходит. Плазмодий активно мигрирует (около 0,1 мм в минуту) в поисках пищи посредством характерного амебоидного движения с поступательным током цитоплазмы.

Питание осуществляется бактериальными и дрожжевыми клетками, а также частичками детрита.

В какой-то момент под воздействием определенных факторов среды ядра плазмодия претерпевают мейоз, образовавшиеся гаплоидные ядра окружаются собственными оболочками, образуя споры. Одновременно из протоплазматического содержимого плазмодия формируется спорокарп, твердая и неподвижная стадия, приспособленная для рассеивания спор. Жизненный цикл на этом замыкается.

2.2. Морфология спорокарпов миксомицетов В последние годы быстро развивается молекулярная филогения миксомицетов, изменяя устоявшиеся представления об их таксономии [49, 55, 56, 57, 58, 59, 60, 156, 158, 217].

Однако до сих пор систематика группы базируется преимущественно на анализе морфологических признаков плодовых тел и спор. Морфологическое разнообразие этих стадий велико и позволяет, как правило, проводить определение видов [109, 116, 117, 152, 154, 165, 235].

Типы спорокарпов миксомицетов Выделяют четыре основных типа: плазмодиокарп, эталий, псевдоэталий, спорангий. Встречаются виды, обладающие спорокарпами промежуточного строения, а также плодовыми телами разных типов в пределах одной колонии. Общая схема строения спорокарпа представлена на Рис. 7.

Ножка спорокарпа Наличие, структура, форма и окраска ножки являются хорошими диагностическими признаками на уровне рода. Например, у видов Comatricha ножка заполнена фибриллярным материалом, у Macbrideola она полая, а у Stemonitis полая или заполнена аморфным материалом. В порядке Trichiales этот признак может иметь значение на видовом уровне.

Рис. 7 Схема строения спорокарпа миксомицетов по [16] с изменениями.

Колонка Может образовываться двумя способами: являться (колумелла) продолжением ножки внутри особого вместилища спор – споротеки (у пор. Stemonitales) или представлять собой вырост в основании сорокарпа (у пор. Physarales). Строение колонки и ее связь с капиллицием (нити капиллиция отходят от апикальной или базальной части колумеллы или равномерно на всем ее протяжении) можно использовать как критерий на родовом и видовом уровне, особенно для представителей сем. Stemonitidaceae. Форма колонки может быть округлой, шиловидной, дисковидной.

Капиллиций Рассеиванию спор при растрескивании перидия способствует специальная структура – капиллиций, развивающаяся внутри споротеки. Он образуется как система вакуолей в протоплазме плазмодия во время его превращения в спорокарп [45, 70, 73, 85]. У представителей некоторых родов сем. Stemonitidaceae (например, Comatricha, Stemonitis) капиллиций формируется путем образования нитей, отходящих от ножки или колонки [188]. Изучение структуры капиллиция привело к изменению взглядов на положение некоторых родов в системе [45, 85].

Перидий Особенности оболочки споротеки, особого вместилища спор в спорокарпе, также имеют систематическое значение. Так, пленчатый, без извести, прозрачный перидий встречается у видов Licea и у большинства родов сем. Trichiaceae, а также в некоторых родах сем. Stemonitidaceae. Кроме того, в систематике учитывается характер растрескивания перидия, наличие отложений солей кальция на нем и количество слоев, из которых он состоит. Двухслойный перидий встречается у родов Perichaena (пор. Trichiales), Physarum и Diderma (пор. Physarales).

Включения кальция Для многих групп миксомицетов при образовании спорокарпа характерно выведение кальция из цитоплазмы в виде солей. У видов пор. Physarales углекислый кальций может откладываться в ножке спорангия, в капиллиции, или на перидии. Отложения кальция могут быть представлены аморфными гранулами (сем.

Physaraceae), кристаллами (р. Didymium) или даже конгломератами кристаллов (р.

Lepidoderma). Таким образом, отсутствие или наличие таких включений и характер их распределения позволяет судить о границах между семействами, порядками и даже родами.

Споры Чаще всего округлые, реже вытянутые или яйцевидные, если лежат свободно.

Если собраны в группы, то могут быть неправильной полиэдрической формы. Цвет споровой массы и отдельных спор является одним из важнейших диагностических признаков в макросистематике группы. Последние исследования в области филогении миксомицетов [60] с использованием частичной последовательности маркерного гена 18S рРНК показали разделение миксомицетов на две основные клады с глубокими различиями в последовательности этого гена. На морфологическом уровне эти группы различаются именно цветом споровой массы и носят соответствующие названия: светлоспоровые и темноспоровые.

При таксономическом определении на уровне вида большое значение имеют особенности строения поверхности оболочки споры (экзоспория) [177, 178, 202]. Основными элементами экзоспория являются бородавочки и шипы, составляющие в совокупности орнаментацию споры. Основное различие этих структур выражается в том, что бородавочка имеет закругленную вершину, а шип заостренную. При этом бородавочки могут быть различной формы: одно- или многовершинными, булавовидными. Экзоспорий без орнаментации встречается довольно редко и характерен преимущественно для порядков Liceales и Echinosteliales. Напротив, среди представителей порядков Physarales и Stemonitales распространен бородавчатый и шиповатый тип экзоспория.

Орнаментация экзоспория может быть равномерной по всей поверхности споры или образовывать скопления. В том случае, если элементы орнаментации сливаются между собой, говорят о сетчатом типе экзоспория. Последний характерен для порядков Trichiales, Stemonitales и Physarales. Таким образом, орнаментация спор может служить хорошим морфологическим критерием при разграничении сложных видовых комплексов миксомицетов [26, 36, 86, 150, 176, 177, 178, 189, 235].

Рис. 8 Разнообразие спор и орнаментации экзоспория миксомицетов [201].

2.3. Экология и география миксомицетов Миксомицеты чрезвычайно широко распространены в наземных экосистемах.

Являясь важным компонентом почвенных микробных сообществ, они потребляют другие микроорганизмы и частицы органического вещества [50]. Число спор слизевиков может достигать 104–107 на 1 грамм почвы [113].

Типичными местами обитания миксомицетов помимо почвы являются древесные остатки и листовой опад, обычно во влажных затененных местах. Немногие виды приурочены к помету растительноядных животных [44], другие формируют спорокарпы на мхах и печеночниках [197, 219], некоторые обитают на коре живых деревьев и кустарников [74, 199] или на их отмерших частях [37, 222]. Отдельный интерес представляют криотолерантные нивальные виды, способные образовывать спорокарпы рядом с тающим снегом и обитающие преимущественно в горах [97, 119, 162].

Видовое богатство миксомицетов может значительно меняться в пределах одной природной зоны в связи со сменой типов растительных сообществ. Наибольшее видовое богатство отмечено в листопадных и хвойных лесах умеренного климата [14, 16, 215, 218], в то время как в тропических лесах и в аридных регионах оно намного ниже [77, 79]. В последнее время в результате специальных исследований, которые проводятся в различных природно-климатических зонах, удалось выявить ряд закономерностей в изменении таксономического состава миксомицетов в широтно-зональном градиенте [155, 218].

ГЛАВА 3. ИСТОРИЯ ИЗУЧЕНИЯ НИВАЛЬНЫХ МИКСОМИЦЕТОВ

На сегодняшний день известно около 70 видов нивальных миксомицетов. До последнего времени считалось, что нивальные виды обитают только в субальпийском или альпийском поясах высокогорий, где наблюдается их наибольшее видовое богатство. Не случайно в отношении этой группы в литературе довольно долго использовался термин «альпийские виды» (“alpine species”) [78, 79, 91, 96, 98, 112, 138, 221]. При этом исключительно в альпийском поясе было зарегистрировано только 36 видов, большая же часть нивальных миксомицетов известна из пояса хвойных лесов и субальпийских криволесий [181]. Согласно мнению большинства специалистов, открытые высокогорные местообитания с травянистой растительностью являются наиболее типичными для нивальных миксомицетов [106, 190, 191]. Последние данные говорят о том, что нивальные миксомицеты также могут встречаться в равнинных местах обитания на незначительных высотах [15, 148, 164, 225].

Впервые термин «альпийские виды» в отношении нивальных миксомицетов предложил еще в 19-м веке Эрик Фриз [67], изучавший слизевиков в горах Ямтланда. Он же опубликовал первые описания нивальных миксомицетов [68]: Physarum vernum Sommerf. in Fries и Stemonitis cribrarioides Fr., являющийся теперь синонимом Lamproderma cribrarioides (Fr.) R.E. Fr. На основании собственных данных, а также информации о слизевиках Европы и Северной Америки, он заметил, что некоторые виды (Trichia alpina (R. E Fr) Meyl., Lepidoderma granuliferum (W. Phillips) R.E. Fr., Diderma fallax (Rostaf) Lado) ни разу не были отмечены в равнинных местах обитания, и предположил, что они связаны исключительно с альпийскими биотопами. Позднее Ковальский [96] подчеркнул, что большая часть видов родов Lepidoderma и Lamproderma также является альпийскими.

Однако специальные исследования этой группы были проведены только в первой половине 20-го века Чарльзом Мейланом [122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137]. Ч. Мейлан был школьным учителем, сделавшим значительный вклад в изучение мхов, лишайников и миксомицетов Швейцарии. Почти все его исследования проводились в Юрских горах (Jura Mts.), в местности Санте Круа (Sainte Croix) недалеко от его дома. Всего им было опубликовано 22 статьи, посвященные миксомицетам, в которых он описал пять новых родов, 36 видов, 49 разновидностей. Позже некоторые исследователи предприняли попытку провести ревизию коллекции Мейлана, большая часть образцов которой хранится в Ботаническом музее в Лозанне (Muse Botanique Cantonal, Lausanne, Switzerland). В частности Ковальскому удалось выделить некоторые лектотипы из его коллекции, а в других случаях из-за плохой сохранности материала и недостатка информации в протологах Мейлана, он был вынужден описать неотипы [97]. Морено и Сингер провели детальные исследования спор ряда видов из коллекций Мейлана с использованием сканирующего электронного микроскопа [143, 208]. В результате этих исследований некоторые виды, были переведены в синонимы, а из пяти описанных Мейланом родов этими авторами были признаны только три.

В последнее время нивальные миксомицеты стали объектом интенсивных исследований, прежде всего в районах с высокогорным ландшафтом в Альпах, Пиренеях, Сьерра-Невада, горах Шотландии, Скандинавии и Карпатах. Целый ряд работ проведен во Франции [32, 33, 34, 35, 103, 104, 105, 106, 119, 120, 121, 174, 175], Испании [77, 144, 146, 191, 207], Италии [30, 171], Германии [101], Шотландии [78], Швеции [66, 193], Австрии [143, 210], Греции [200], Польше [180], Болгарии [182] и Украине [6, 99]. В Азии они зарегистрированы в Японии [140, 224, 225, 226, 227, 237, 238, 239]. В Северной Америке нивальные миксомицеты были исследованы, прежде всего, в Калифорнии и штате Вашингтон [92, 94, 95, 98, 141, 142, 208], а в Южной Америке в Аргентине [183, 234].

До сих пор для горных мест обитания в России было проведено только одно исследование нивальных миксомицетов в Хибинах [164]. Однако нивальные миксомицеты также были зарегистрированы в таежном лесу равнинного ландшафта Ленинградской области [15]. Следует отметить, что нивальные миксомицеты известны также из равнинных мест обитания Германии [148] и Японии [225]. Эти данные, а также предварительные результаты исследования образцов почв методами метагеномики [81], указывают на возможное присутствие популяций амеб некоторых видов нивальных миксомицетов в почвах таежных хвойных и листопадных лесов вне горных систем.

Это обстоятельство заставляет предположить, что биогеографический паттерн нивальных миксомицетов значительно сложнее, чем предполагалось, и что среди них могут присутствовать как истинные «альпийцы», так и виды с более широким ареалом распространения.

В последнее время Анной Роникер была предпринята попытка осмыслить полученный материал и выявить закономерности распространения нивальных миксомицетов на высотном градиенте [180]. В этой работе альпийские виды рассматривались как встречающиеся преимущественно в альпийском высокогорном поясе с безлесной растительностью. При этом понятие «субальпийского пояса» несколько размыто по сравнению с «альпийским поясом» и трактуется разными авторами по-разному. Роникер под этим термином подразумевала переходную зону, отделяющую пояс лесов от альпийской безлесной растительности [90, 231]. В работе был сделан вывод, что нивальные миксомицеты не могут считаться экологической группой, связанной только с альпийскими биотопами. Также было показано, что такие нивальные виды, как Diacheopsis pauxilla Mar.

Mey. et Poulain, Diderma fallax, D. niveum (Rostaf.) T. Macbr., Lamproderma retirugisporum G.Moreno, H.Singer, Illana & A.Snchez, L. sauteri Rostaf, Lepidoderma granuliferum, L.

perforatum Mar. Mey. & Poulain, Physarum albescens Ellis ex T. Macbr, Ph. alpinum (Lister et G.

Lister) G. Lister и Trichia sordida Johannesen, в горах встречаются преимущественно выше субальпийского пояса. Кроме того, поскольку Collaria nigricapillitia (Nann.-Bremek. & Bozonnet) Lado, Dianema inconspicuum Poulain, Mar. Mey. et Bozonnet, Diacheopsis pauxilla, Didymium nivicolum Meyl., Lamproderma cacographicum Bozonnet, Mar. Mey. & Poulain, Lepidoderma granuliferum, L perforatum и Trichia sordida никогда не были найдены в равнинных ландшафтах, было сделано предположение, что центр распространения устойчивых популяций этих видов находится выше субальпийского пояса, хотя некоторые заносные популяции могут существовать короткое время в горах на низких высотах [181].

ГЛАВА 4. МАТЕРИАЛЫ И МЕТОДЫ

Выявление нивальных миксомицетов в природе и анализ их распространения осложняется тем, что плодовые тела этих видов могут быть обнаружены в природе лишь в течение очень короткого периода, когда происходит весеннее таяние снега. Кроме того они крайне редко могут быть изолированы в лабораторных условиях с помощью техники влажных камер, которая успешно применяется для изучения других экологических групп, например эпифитных видов, а также видов формирующих спорокарпы летом и осенью на опаде и выветрившемся помете растительноядных животных [16, 154, 201]. По этим причинам для изучения нивальных миксомицетов в этой работе использовался ряд зарекомендовавших себя методов.

4.1. Методы сбора и обработки материала Использованная в исследовании коллекция нивальных миксомицетов собиралась нами в течение нескольких полевых сезонов и включает в себя: 705 образцов из Хибин (июнь 2012, 2013 гг.), 534 образца из Теберды (май–июнь 2010–2013 гг.), 157 образцов из Ленинградской области (май 2009, 2011–2013 гг.) и 26 образцов с острова Валаам (сентябрь 2008 г., май 2013 г.).

Собранные образцы пополнили коллекцию микологического гербария Лаборатории систематики и географии грибов Ботанического института им. Комарова РАН (LE) а также частную коллекцию (sc) проф. Мартина Шниттлера (Институт ботаники и ландшафтной экологии Университета Эрнста-Морица, города Грайфсвальд, Германия).

Большинство колоний нивальных миксомицетов можно было определить до рода уже в полевых условиях, даже в случае высохших и потому частично разрушенных экземпляров.

Однако определить образцы до вида удавалось в полевых условиях очень редко. Исключение составлял Physarum albescens, массово встречавшийся в Хибинах. Техника сбора и подготовки гербарных образцов миксомицетов подробно описана в работе Новожилова с соавторами [158]. Для видовой идентификации образцы изучались в лаборатории с помощью световой и в ряде случаев электронной микроскопии. Кроме того, для некоторых образцов были проведены молекулярно-генетические исследования с использованием молекулярных маркеров.

Все спорокарпы, расположенные на одном субстрате в непосредственной близости друг от друга (вероятно развившиеся из одного плазмодия) расценивались, как одна колония.

Каждая колония, отстоящая более чем на 25 см от другой, принималась за отдельный образец.

Всего для подготовки диссертации было использовано 1422 гербарных образца и 20 полевых записей, 17 из которых относились к Ph. albescens и 3 к плохо развившимся спорокарпам р. Diderma.

Для морфологического определения высушенные спорокарпы исследовались с помощью бинокуляра Carl Zeiss Stemi 2000. Цифровые фотографии спорокарпов получали с использованием камеры AxioCam MRc5 и программы CombineZ. Для уточнения определения из спорокарпов и спор были сделаны полупостоянные микроскопические препараты, заключенные в поливинил лактофенол. Изображения препаратов были получены с помощью светового микроскопа Carl Zeiss Axio Imager A1 с иммерсионным объективом Zeiss ECPlan NEOFLUAR 100X/1,3 Oil, камеры AxioCam MRc5 и программы Axio Vision 4.8.0.0 (Carl Zeiss Imaging Solutions). Морфометрические данные микроскопических признаков спор, включая орнаментацию, даны как средние значения измерений 5 различных спор каждого образца.

При описании морфологических признаков использовалась система обозначения цветов ISCC-NBS [28].

Электронномикроскопические фотографии поверхности спор, капиллиция и перидия были получены с помощью сканирующего электронного микроскопа JSM-6390 LA. В некоторых случаях при подготовке материала к просмотру в сканирующем электронном микроскопе использовалась криофильная сушка. В этом случае образцы предварительно фиксировали в 2,5 % глютаральдегиде и затем обезвоживали в серии спиртов различной крепости, смеси ацетона и изомилацетата как это описано у Сингера с соавторами [207].

Образцы монтировались на медные столики с помощью двухсторонней клейкой ленты, после чего происходило напыление золотом.

Номенклатура нивальных миксомицетов дана согласно Пулэну с соавторами [175], а также в соответствии с номенклатурной электронной базой данных Ладо [102]. Авторы таксонов процитированы согласно Кирку [89].

4.2. Молекулярные методы таксономического определения Для некоторых образцов морфологическое определение оказывалось затруднительным, поэтому для них были получены частичные последовательности маркерного гена 18S рРНК.

Полученные последовательности были размещены в электронной интернет базе данных GeneBank (NCBI) под номерами, указанными в Приложении 2.

ДНК выделялась из спор, взятых из 5-10 спорокарпов гербарных образцов.

Спорокарпы растирались в микропробирке с 100 мкл смеси комплекса ферментов, разрушающих клеточные стенки, растворенных в BFLE буфере (0,1 M цитрата натрия рН=6,0, 20 мМ EGTA, 5 % BSA) в концентрации 2 мг/мл. Высвобожденные споры в течение часа оставались в растворе при комнатной температуре. Далее микропробирки центрифугировались при 10 000 об/мин в течение 6 минут для осаждения спор. Надосадок с остатками ферментной смеси удалялся, споровая масса дважды промывалась в натриевофосфатном буфере (0,1 М). Дальнейшее выделение ДНК шло в соответствии с протоколом набора реагентов Axygen за исключением последнего этапа, когда ДНК растворялась в 50 мкл проявителя, а не в 200 мкл.

Амплификация проводилась для фрагмента гена длинной около 650 пар оснований, свободного от интронов, с использованием пары праймеров S2

С) и (TGGTTGATCCTGCCAGTAGTGT, tплавления = 55 SU19R С) При постановке ПЦР (TCGAGTAACAATTAGAGGACA, tплавления = 56 [56].

использовалась смесь iQ Supermix (Bio-Rad), состав и объемы реагентов для конечной ПЦР смеси указаны в Табл. 1.

Табл. 1 Состав ПЦР-смеси с использованием iQ Supermix. Указаны объемы реагентов на одну пробу общим объемом 30 мкл.

Реагент Исходная концентрация Объем, мкл Деионизированная вода - 12,4 Прямой праймер 3 мкм/мл 0,3 Обратный праймер 3 мкм/мл 0,3 ДНК - 2,0 iQ Supermix 2х 15,0

При амплификации соблюдался следующий протокол ПЦР:

95 С – 3 мин (первичная денатурация) 95 С – 30 сек (денатурация) 55 С – 30 сек (отжиг праймеров) 40 раз 72 С – 48 сек (элонгация) 72 С – 5 мин (финальная элонгация) Амплификация проводилась на термоциклере С1000 (Bio-Rad).

Для визуализации результатов ПЦР 5 мкл пробы перемешивались с 1 мкл буфера для нанесения (Fermentas) и помещались в 1 % агарозный гель, куда предварительно было добавлено 2 мкл интеркалирующего ДНК-красителя GelRed. Затем гель с внесенными образцами помещался в электрическое поле (80 В, 100 мА, 70 Вт) на 40 минут. Далее полосы на геле фотографировались с помощью системы документации Bio-Rad GelDoc XR в программном пакете Quantity One. За внутренний стандарт принималась полинуклеотидная смесь Axygen DNA Ladder 100 bp.

Очистка ПЦР-продуктов проводилась с применением наборов Qiagen QIAquick PCR Purification Kit или Axygen PCR Purification Kit согласно протоколу производителя Очищенные продукты ПЦР затем использовались в секвенирующей ПЦР с набором реагентов Big Dye XTerminator Cycle Sequencing Ready Reaction Kit (Applied Biosystems).

Состав и объемы смеси для секвенирующей ПЦР смеси указаны в Табл. 2.

Очистка продуктов сиквенсовой реакции от не включившихся терминаторов производилась с помощью 75 % изопропанола. Для этого в микропробирки с продуктами сиквенсовой реакции добавлялось по 50 мкл изопропанола, смесь взбалтывалась на вортексе, инкубировалась 15 минут при комнатной температуре и центрифугировалась при 10 000 об./мин в течение 20 минут. Затем надосадок удалялся, в пробирку добавлялось по 100 мкл изопропанола. Микропробирки со смесью трижды перемешивались опрокидыванием, смесь снова центрифугировалась при 10 000 об./мин в течение 2 минут. Далее все пробы полностью высушивались от спирта в термостате при температуре 60° С, растворялись в 20 мкл Hi-DiTM Formamide и перемешивались на вортексе.

Секвенирование осуществлялось на секвенаторе ABI 3130 Genetic Analyzer.

Выходные данные секвенатора обрабатывались в программе ABI Sequencing Analysis 5.3.1 или Sequencher 4.7 Табл. 2 Состав ПЦР-смеси с использованием Big Dye XTerminator Cycle Sequencing Ready Reaction Kit. Указаны объемы реагентов на одну пробу общим объемом 10 мкл.

Реагент Исходная концентрация Объем, мкл Деионизированная вода - 4,3 Прямой/обратный праймер 3,2 пикомоль 2,0 ДНК - 1,0 буфер 5х 2,0 RRMix (BigDye) - 0,7

4.3. Математические методы Сравнение сообществ нивальных миксомицетов из разных типов растительности было проведено с использованием канонического анализа соответствий (canonical correspondence analysis, CCA) в программе PcOrd 5.0.

Все типы субстратов, на которых были зарегистрированы нивальные миксомицеты, были объединены в три основные группы: гн. др. = крупные остатки гнилой древесины (стволы, толстые ветки, пни и т.д.); ЖИВЫЕ РАСТЕНИЯ = живые травянистые растения, кустарники, кустарнички и низко расположенные ветви деревьев; опад = наземный опад листьев и трав.

Для сравнения видового состава нивальных миксомицетов из локальных сообществ, на различных типах субстрата, а также из разных районов исследования был использован модифицированный коэффициент сходства Чао-Серенсена [38, 39, 42], основанный на учете встречаемости отдельных видов. Матрицы коэффициентов сходства были получены с помощью программы EstimateS 9.10 [38, 39, 41], визуализация результатов дендрограмм сходства получена в программе Statistika 8.

Виды, классифицированные, как редкие (относительная частота встречаемости 0,5 % от общего количества учетных записей) были исключены из этого анализа.

Для оценки ожидаемого числа видов в изученных районах, а также полноты исследования, нами использовался подход, разработанный Готелли, Колуэллом и Чао [41, 42, 72] на основе алгоритма генерации псевдовыборок [22]. Для расчета ожидаемого числа видов в генеральной совокупности, из которой была сделана общая выборка, использовался скорректированный индекс Chao1 (bias-corrected index). Индекс рассчитывался с учетом числа видов, представленных только одним образцом (singletons) и более чем одним образцом (doubletons). Расчет проводился в программе EstimateS 9.10. Представление результатов в виде графиков было получено в программе SigmaPlot 10.0.

Для оценки полноты исследования для каждого изученного района был подсчитан коэффициент полноты сбора, С (коэффициент Тьюринга) [71, 240]:

C = 1–f1/S 100 %, где f1 – количество видов, представленных только одним образцом, а S – общее число учетных записей. Общее число ожидаемых видов на исследованных территориях (T) было высчитано, как T = S/C.

Оценка встречаемости проводилась по шкале Стефенсона [214] и высчитывалась как процент образцов конкретного таксона от общего числа образцов для каждого набора данных: Р – встречается редко (0,5 %); И – встречается иногда (0,5–1,5 %); М – встречается массово (1,5–3 %); Ч – встречается часто (3 %).

Альфа-разнообразие видов было вычислено с помощью индекса Шеннона:

H’ = – Pi ln Pi, где Pi – относительная численность конкретного вида (доля от общего числа находок) [114].

Списки видов нивальных миксомицетов из различных мест обитания сравнивали на основании индекса выравненности Пиелоу:

E = H/ ln(S) и индекса доминирования Симпсона:

D = Pi2 Среднее количество видов на род (В/Р) использовали как индикатор общего таксономического разнообразия [19, 100, 206].

4.4. Исследование фенологии спороношения нивальных миксомицетов Для исследования влияния микроклиматических факторов на рост миксамеб и образование спорокарпов нивальных миксомицетов в 2010 году в Тебердинском государственном природном биосферном заповеднике (Северо-Западный Кавказ) была заложена трансекта, которая наблюдалась в течение трех последующих лет. Каждый год всю трансекту проходили и изучали в течение нескольких дней (11.–14.06.2010; 18.–30.05.2011;

01.–08.06.2012; 03.–07.06.2013). В пределах трансекты были заложены 20 пробных площадей (ПП) в виде участков около 50 м в диаметре (Рис. 3), в пределах которых фиксировалась каждая найденная колония нивальных миксомицетов. Там, где это было возможно, для каждой колонии регистрировались следующие параметры: экспозиция, наклон, тип растительности, расстояние до ближайшего снежника, тип субстрата (опад или живые растения), высота и количество спорокарпов на колонию. В 2010 и 2011 было зафиксировано столь массовое плодоношение, что только для 50 % находок имеются подобные точные данные.

Для изучения микроклиматических параметров, формирующихся зимой под снежным покровом, было установлено 16 микроклиматических станций (логгеров) HoboPro V2, на высотах от 1 700 до 2 770 м н.у.м. (подробные характеристики даны в Приложении 3).

Логгеры были зафиксированы в пластиковых контейнерах, которые были закрыты сверху для защиты от животных, дождя, солнечного света и возможного схода лавины. Контейнеры были вкопаны в землю на половину своей высоты, так чтобы зонд логгера находился на уровне почвы. В течение периодов с 15.05.2011 по 01.06.2012 и с 01.09.2012 по 01.06.2013 логгеры измеряли окружающую температуру (°C) и относительную влажность с интервалами в 30 мин, производя 48 измерений в день. Поскольку сильные флуктуации относительной влажности в какой-то момент прекращались, а относительная влажность оставалась постоянной около 100 %, на основании этого делался вывод об установлении постоянного снежного покрова. Таким образом, была рассчитана длительность снежного покрова (все дни с относительной влажностью 97 % и средней дневной температурой до 3° C).

Число дней, подходящих для роста популяции амеб нивальных миксомицетов рассчитывалось, на основании совпадения двух факторов: наличия снежного покрова и температуры выше –0,5°C. Дополнительные данные о погоде были взяты с метеостанции на перевале Клукхор (1 970 м н.у.м., 43°15’17.5” с. ш., 41°49’19.4” в. д). Данные оценивались по средней дневной температуре (взятой на высоте 2 м) и снежному покрову за период с 01.01.2009 по 31.12.2013 [29]. Наконец нами была измерена температура почвы вокруг снежников за период с 25.–26.11.2011. Чтобы получить данные о температурном градиенте, температура почвы была измерена на самой границе со снежником в полдень солнечного дня (максимальная температура) и следующим утром (минимальная температура). Сходным образом были измерены температуры почвы в солнечные и облачные дни.

4.5. Культивирование миксамеб Оценка способности выживать в условиях низких температур была сделана на основе оригинальных наблюдений, выполненных студентом биолого-почвенного факультета СанктПетербургского Государственного Университета О.Н. Щепиным.

Споры нивального вида Lepidoderma chailletii Rostaf. (образцы LE296753, LE 296754, LE 297153) были высеяны на голодный 1,5 % агар [223] и инкубировались при 2° C на занесенных вместе со спорами сопутствующих бактериях. Далее для каждого образца часть колонии вышедших из спор миксамеб была пересеяна на новый агар (всего 5 чашек).

Каждая из пяти чашек выдерживалась при одном из пяти возможных температурных режимов:

a) 2° C (имитация отрытой не замерзшей земли, ограниченной тающим льдом);

б) 0° C (температура, которую можно ожидать под толстым снежным покровом);

в) –11° C с акклиматизацией, то есть охлаждение до 0° C в течение 24 часов, до –5° C в течение 6 часов, до –11° C в течение 24 часов (имитация замерзания, смягченного тонким снежным покровом);

г) –18° C с акклиматизацией, как описано выше (имитация сильного замерзания, смягченного тонким снежным покровом);

д) –11° C, без акклиматизации, то есть охлаждение до –11° C в течение 1 часа (имитация быстрого замерзания без защищающего снежного покрова).

После воздействия режима чашки переносились обратно в холодильник, поддерживающий температуру 2° C на 4 дня. По истечении этого срока производился подсчет и вычисление доли активных, инцистировавшихся или погибших амеб путем подсчета тел или их остатков в инвертированном световом микроскопе при десятикратном увеличении. В общей сложности было обсчитано 3 случайных поля зрения, в каждом обнаружено от 50 до 150 амеб или их остатков, а затем процент активных, инцистировавшихся или погибших амеб рассчитывался с учетом плотности амебоидных клеток в разных частях культуры.

ГЛАВА 5. АННОТИРОВАННЫЙ СПИСОК НИВАЛЬНЫХ МИКСОМИЦЕТОВ

Имена авторов таксонов даны в соответствии с Кирком [89] и Ладо [102]. Данные о пробных площадях (ПП) приведены в Приложении 1. Данные о гербарных образцах, хранящихся в микологическом гербарии БИН РАН (LE), а также гербарии Грайфсвальдского университета (Германия) в коллекции проф. М. Шниттлера (sc), приведены в Приложении 2.

В списке после названия вида и фамилии его автора в круглых скобках указывается оценка встречаемости и число его находок во всей коллекции. Далее следуют названия районов исследования, где были зарегистрированы находки рассматриваемого вида, и также в круглых скобках оценка встречаемости и число находок образцов в конкретном месте обитания (кроме Валаама, где малое число находок не позволило провести оценку встречаемости). Затем приводится число находок для каждого из обследованных типов растительности, и далее – число находок вида на каждом из возможных типов субстрата. В круглых скобках после сокращения «ПП» дан перечень пробных площадок, где вид был зарегистрирован.

Сокращения, принятые в списке:

Районы исследования Хиб. = горный массив Хибины; СЗ.Кав. = Северо-Западный Кавказ; Вал. = о. Валаам; Лен. = Ленинградская область.

Типы растительности Условные обозначения для типов растительности с расшифровкой приводятся в Главе 1.

Субстраты Условные обозначения для типов субстратов, а также их расшифровка приведены в Главе 4.3.

Оценка встречаемости Условные обозначения для рангов оценки встречаемости и их расчет также приведены в Главе 4.3.

Для описания окраски некоторых морфологических структур использовалась система описания цветов ISCC-NBS [28].

Под последовательностями в списке подразумеваются частичные последовательности маркерного гена 18S рРНК.

Аннотированный список видов:

Diacheopsis effusa Kowalski; (Р, 1); Хиб. (Р, 1); БС: 1; опад: 1 (ПП: 66).

Вид найден только один раз в 1994 году на прошлогодних стеблях Anthriscus sylvestris (L.) Hoffm., лежащих на почве под покровом плотных зарослей Heracleum mantegazzianum Sommier & Levier, на краю луга в переходной зоне между березовым субальпийским криволесьем и альпийской тундрой.

Ключевыми признаками вида являются: уплощенные крупные плазмодиокарпы до 30 мм длин. и 1 мм толщ., покрытые пленчатым перидием с металлическим блеском; нити капиллиция, образующие густую крупноячеистую сеть, иногда с воронковидными расширениями на концах; споры (11–) 12–12,5 (–13) мкм диам., орнаментированные шипиками до 0,2 мкм длин. Морфология найденного образца хорошо согласуется с типовым описанием [95]. Данный вид отличается от других видов рода плазмодиокарпоидным типом спорокарпов, характером орнаментации спор и длительно сохраняющимся перидием (Рис. 9). Внешне напоминает D. serpula Kowalski [95], но у этого вида перидий быстро разрушается после созревания. Другие два близких вида отличаются: D. vermicularis Nann.-Bremek. & Y. Yamam.

[149] наличием маленьких бородавчатых спор и D. reticulospora Mar. Mey. & Poulain [121] сетчатой орнаментацией спор.

Рис. 9. Строение капиллиция и перидия Diacheopsis effusa LE48364 (SEM).

Diacheopsis metallica Meyl.; (Р, 2); Хиб. (Р, 2); БС: 1, АТ: 1; ЖИВЫЕ РАСТЕНИЯ: 1, опад: 1 (ПП: 8, 13).

Наши образцы представлены маленькими плазмодиокарпами или сидячими спорангиями (Рис. 10 А), чья морфология соответствует описанию данного вида [130], который сходен с Diacheopsis kowalskii Mar. Mey. & Poulain. Морено с соавторами [142] указывает на различия между этими двумя видами: D. metallica имеет нити капиллиция с небольшим числом расширений в местах ветвления и на концах нитей (Рис. 10 Б, В), а нити капиллиция D. kowalskii имеют широкие пленчатые (иногда треугольные) расширения в местах ветвления. D. metallica имеет маленькие споры (10,5–) 13,4 (–11,7) мкм диам., орнаментированные крупными выростами – бакулами (Рис. 10 Г); напротив, у D. kowalskii споры имеют 15–17 мкм в диам. и орнаментированы бакулами меньшего размера. Следует отметить, что род Diacheopsis может представлять собой аберрантные формы ряда видов рода Lamproderma, спорокарпы которых в норме имеют ножки. На это указывает сходство или даже идентичность последовательностей видов Diacheopsis с последовательностями некоторых видов Lamproderma со сходной орнаментацией спор [60].

Рис. 10. Морфологические особенности Diacheopsis metallica LE289796. А – сидячие спорангии. Б – общий вид нитей капиллиция. В – места ветвления на концах нитей капиллиция (SEM). Г – характер орнаментации спор (SEM). Линейка: А – 1 мм; Б – 100 мкм;

В – 20 мкм; Г – 1 мкм.

Diacheopsis reticulospora Mar. Mey. & Poulain; (Р, 2); Хиб. (Р, 2); БС: 2; опад: 2 (ПП: 33).

Редкий вид, для которого характерны спорокарпы в виде плазмодиокарпов и мелкосетчатая орнаментация спор (Рис. 11).

Рис. 11. Характер орнаментации споры Diacheopsis reticulospora LE296991 (SEM).

Dianema subretisporum Kowalski; (Р, 1); СЗ.Кав. (Р, 1); АЛПа: 1; опад: 1 (ПП: 82).

Этот редкий вид (Рис. 12 А) имеет типичные признаки рода: споры, светло-коричневые в массе и светло-желто-коричневые в проходящем свете микроскопа (Рис. 12 Б), 12–13 мкм диам., и светло-коричневые гладкие нити капиллиция с заостренными кончиками, прикрепленные к внутренней поверхности перидия. Интересно, что у этого вида нити капиллиция связаны с остатками перидия, как у Meriderma, но не имеют дланевидных расширений (Рис. 12 В). Орнаментация спор представлена незамкнутой сеточкой со стенками до 1 мкм высотой (Рис. 12 Г). Единственная последовательность, полученная дважды, имеет мотив (tctctct), характерный для темноспоровых миксомицетов [60].

Поскольку данный вид относится к светлоспоровым видам, требуется повторное секвенирование для исключения возможности контаминации.

Рис. 12. Морфологические особенности Dianema subretisporum LE285226. А – общий вид спорокарпов. Б – вид спор в проходящем свете микроскопа. В – окончания нитей капиллиция. Г – сетчатый характер орнаментации спор. Линейка: А – 1 мм; Б, В, Г – 10 мкм.

Diderma alpinum (Meyl.) Meyl.; (Ч, 199); Хиб. (Ч, 143); СЗ.Кав. (Ч, 50); Лен. (Р, 1);

Вал. (5); БС: 106, АТ: 37, БСК: 8, АЛПа: 26, АЛПб: 16, ЕЧ: 3, СЧ: 3; ЖИВЫЕ РАСТЕНИЯ:

102, опад: 97 (ПП: 1, 2, 4, 8–10, 15, 17–21, 23–28, 30–33, 38, 41, 45–47, 49–52, 65, 70, 77–80, 82, 87, 89, 90, 96 –98, 105, 109, 111–113).

Морфология спорокарпов большинства изученных образцов хорошо соответствует описанию данного вида [143]. Среди проанализированных образцов преобладают плодовые тела в виде слившихся спорокарпов (плазмодиокарпов) (Рис. 13 А), реже были отмечены колонии с преобладанием отдельных спорангиев (Рис. 13 Б). Перидий двойной, наружный слой белый, иногда с кремовым оттенком, скорлуповидный; внутренний слой относительно толстый, желтоватый под световым микроскопом, инкрустирован плотным слоем мелкой аморфной извести, из-за чего выглядит серым, матовым. При растрескивании перидий лопается в верхней части споротеки и довольно долго сохраняется в ее нижней части в виде пленчатых долек. Колонка желтовато-оранжевого или кремового цвета, развита слабо.

Капиллиций беловатый, нитевидный, без отложений кальция, нити тонкие, с прозрачными светлыми окончаниями, прочно связанными с внутренней поверхностью перидия, (0,5–) 2,0 (–3) мкм диам. Споры шаровидные или слегка вытянутые, 10–12 мкм диам., коричневые в проходящем свете, шиповатые (Рис. 13 В).

В нашей коллекции образцы вида с Северо-Западного Кавказа представлены тремя генотипами, выявленными при анализе семи последовательностей. Интересно, что наиболее часто встречающийся генотип (JQ812626) включает также образцы, которые первоначально были определены как D. meyerae (например, LE285165). Это указывает на высокое генетическое и морфологическое разнообразие в пределах одного морфовида.

Diderma fallax (Rostaf.) Lado; (Р, 5); СЗ.Кав. (И, 5); БСК: 1, АЛПа: 2, АЛПб: 2; опад: 5 (ПП: 78, 81, 82, 86).

Спорокарпы на коротких ножках или сидячие, скученные, почти шаровидные 1–1,5 (–2) мм диам., белые или желтоватые с розовым оттенком (Рис. 13 Г). Ножка морщинистая, толстая, прямая, имеет расширение внизу. Перидий двойной, наружный слой толстый, иногда ребристый, в нем много отложений кальция, внутренний слой пленчатый, непрозрачный, розоватый или кремовый, темно-желтый. Колонка крупная, булавовидная (Рис. 13 Д), достигает центра споротеки, белая, розовато-кремовая или светло-коричневая, без оттенков оранжевого цвета. Нити капиллиция жесткие, ветвящиеся и соединяющиеся между собой, с расширениями, неравномерно окрашенные, в основном темно-коричневые в проходящем свете микроскопа (Рис. 13 Е). Споровая масса темно-коричневая, сами споры также темно-коричневые в проходящем свете, 14–16 (–17) мкм диам., с крупными тупоконечными шипиками свыше 1 мкм, иногда до 1,5 мкм длин.

Данный вид хорошо отличается по своей морфологии от других нивальных видов этого рода, и его определение, как правило, не вызывает сомнения. Наиболее близок по морфологии спорокарпов к нему вид Lepidoderma peyerimhoffii Maire & Pinoy, который, однако, имеет споры меньшего размера, 12–14 мкм диам., орнаментированные короткими шипиками до 0,8 мкм длин. Тем не менее, сходство двух полученных в ходе работы последовательностей Diderma fallax с теми, которые были получены для Lepidoderma peyerimhoffii [157], указывает на то, что мы имеем дело с одним видом.

Diderma globosum var. europaeum Buyck; (М, 44); Хиб. (М, 20); СЗ.Кав. (Ч, 24); БС: 19, АТ: 1, БСК: 12, АЛПа: 8, АЛПб: 4; живые растения: 17, опад: 27 (ПП: 1, 4, 8–10, 15, 16, 20, 70, 80–82, 87, 88, 96, 97).

Спорокарпы немного уплощенные, чисто белые, около 1 мм диам., обычно в виде коротких плазмодиокарпов (Рис. 13 Ж). Перидий двухслойный, наружный слой белоснежнобелый, скорлуповидный, внутренний слой пленчатый серовато-белый, со слабым радужным отливом, хорошо отделяющийся от наружного слоя. Колонка уплощенная, иногда недоразвитая, чисто белая (Рис. 13 З). Нити капиллиция светлые, серовато-белые, извилистые, при растрескивании перидия остаются связанными с колонкой; под световым микроскопом нити обычно светло-коричневые с темными утолщениями (Рис. 13 И). Споры шаровидные 10–13 мкм диам., более темные на одной стороне, шиповатые.

Diderma meyerae H. Singer, G. Moreno, Illana & A. Sanchez; (Ч, 93); Хиб. (Ч, 33); СЗ.Кав.

(Ч, 60); БС: 17, AT: 16, БСК: 12, АЛПа: 11, АЛПб: 37; живые растения: 31, опад: 62 (ПП: 17– 19, 23, 24, 26, 28, 30, 32, 33, 46, 55, 57, 65, 70, 78–83, 87, 89, 90, 91, 93, 96–98).

У этого вида внутренний слой перидия обычно слабо инкрустирован известью и вследствие этого имеет радужный блеск (Рис. 13 К). Однако этот признак иногда присутствует и у D. niveum. Наиболее заметными отличиями от других нивальных видов этого рода является орнаментация спор в виде уплощенных бородавок, частично объединенных в неполную сеточку (Рис. 13 Л), под световым микроскопом эта орнаментация выглядит как мелкобородавчатая (Рис. 13 М).

Среди изученных нами восьми образцов с Северо-Западного Кавказа все последовательности образуют один генотип, но среди них два были определены как D.

alpinum и один как D. globosum var. europaeum. Ладо с соавторами [102, 104] считает, что D.

meyerae конспецифична D. niveum из-за сходной орнаментации спор, тогда как французские авторы [174] рассматривают его как отдельный вид. Очевидно, требуются детальные молекулярно-генетические исследования для прояснения этого вопроса.

Рис. 13. Морфология нивальных видов р. Diderma. А – общий вид плазмодиокарпа D.

alpinum LE285669. Б – спорокарпы D. alpinum LE285701. В – капиллиций и споры D. alpinum LE299956. Г – спорокарпы, Д – вид колонки, Е – капиллиций и споры D. fallax LE285149. Ж

– спорокарпы, З – вид колонки, И – капиллиций и споры D. globosum var. europeum LE285137. К – спорокарпы D. meyerae LE285752. Л – вид колонки D. meyerae LE285702. М – капиллиций и споры D. meyerae LE285131. Н – спорокарпы D. microcarpa LE285141. O – спорокарпы D. microcarpa LE285674. П – капиллиций и споры D. microcarpa LE285674. Р – спорокарпы D. niveum LE285719. C – вид колонки D. niveum LE285726. Т – капиллиций и споры D. niveum LE 297041. Линейка: А, Г, Ж – 1 мм; Б, Д, З, К, Л, Н, О, Р, С – 500 мкм; В, Е, И, М, П, Т – 10 мкм.

Diderma microcarpum Meyl.; (М, 27); Хиб. (Ч, 21); СЗ.Кав. (И, 6); БС: 14, АТ: 7, АЛПа:

5, АЛПб: 1; живые растения: 16, опад: 11 (ПП: 2, 4, 8–10, 15, 16, 18–20, 33, 51, 82, 86, 87).

Единственное заметное отличие этого вида от других нивальных видов комплекса D.

alpinum–D. niveum – размер спорангиев в колонии, который обычно не превышает 500 мкм в диам. (Рис. 13 Н, О). Споры существенных отличительных признаков не имеют (Рис. 13 П).

Поскольку размер плодовых тел миксомицетов может сильно варьировать в зависимости от окружающих условий, по-видимому, данный таксон следует рассматривать в качестве миниатюрной формы D. alpinum [102]. Окончательный вывод, однако, можно будет сделать только после проведения подробного молекулярно-генетического анализа.

Diderma niveum (Rostaf.) T. Macbr.; (Ч, 115); Хиб. (Ч, 79); СЗ.Кав. (Ч, 16); Лен. (Ч, 18);

Вал. (2); БС: 44, АТ: 35, БСК: 1, АЛПа: 5, АЛПб: 10, ЕЧ: 19, СЧ: 1; живые растения: 78, опад:

36, гн. д.: 1 (ПП: 8, 9, 12, 14, 15, 17–20, 23, 25, 30, 32, 33, 38, 45–48, 50, 52, 55, 56, 68, 70, 77, 78, 82, 86–88, 90, 100, 101, 108, 112).

Спорокарпы шаровидные, обычно в виде отдельных или плотно сближенных сидячих спорангиев до 3 мм диам., в окраске спорокарпов всегда присутствуют желтоватые или охряно-оранжевые оттенки, особенно в основании споротеки и колонки (Рис. 13 Р). Перидий двухслойный, наружный слой скорлуповидный, внутренний слой хорошо отделяется от наружного, пленчатый, прозрачный, плотно инкрустирован отложениями кальция, из-за этого выглядит серым, матовым, иногда инкрустирован слабо и тогда имеет радужный оттенок. Содержимое плазмодия, не пошедшее на образование плодового тела и лежащее под ним, гипоталлус, иногда сильно пропитан отложениями кальция, а иногда имеет вид прозрачной мембраны. Колонка шаровидная, иногда недоразвитая, оранжево-коричневая с ржаво-красным оттенком, гладкая или шероховатая, несет выросты с отложениями кальция (Рис. 13 С). Капиллиций темный под бинокуляром, темно-коричневый в проходящем свете светового микроскопа, нити капиллиция имеют многочисленные пузырьковидные темные утолщения, видимые в световом микроскопе. Споры в массе темно-коричневые или черные, шаровидные или слегка вытянутые 10–12 (–13) мкм диам., коричневые в проходящем свете, шиповатые (Рис. 13 Т). Форма и размер шипиков, а также их распределение по поверхности спор может сильно варьировать.

По нашему мнению, наиболее характерным признаком данного вида является наличие ржаво-красных оттенков в окраске колонки и темный цвет нитей капиллиция. От близкого вида D. meyerae данный вид отличается другим типом орнаментации спор, основу которой составляет не короткая плоская бородавка, а многовершинная выступающая бородавка, что можно наблюдать на изображениях со сканирующего микроскопа (Рис 14). Что касается окраски внутреннего слоя перидия, то она сильно варьирует от серо-матовой до блестящерадужной, как у D. meyerae.

Следует отметить, что Ладо и Роникиер [102] не признают D. meyerae и считают его разновидностью D. niveum.

–  –  –

Didymium dubium Rostaf.; (И, 21); Хиб. (И, 7); СЗ.Кав. (М, 14); БС: 4, АТ: 3, АЛПа: 7, АЛПб: 7; живые растения: 4, опад: 17 (ПП: 21, 31, 50, 63, 68, 82, 87, 89, 93).

Данный вид формирует распростертые вытянутые плазмодиокарпы до 1,5–2,0 см длиной (Рис. 15). Перидий однослойный, покрыт довольно крупными кристаллами извести до 10–12 мкм шириной. Колонка отсутствует. Капиллиций состоит из густой сети довольно эластичных светлых нитей. Споры 10–12 мкм диам., плотно орнаментированы бородавками, сливающимися иногда в незакрытую сеточку [145].

Рис. 15. Плазмодиокарп D. dubium LE285181.

Didymium dubium f. spiralis ad int.; (Р, 3); СЗ.Кав. (И, 3); СБ: 2, АТ: 1; опад: 3 (ПП: 86, 89).

Внешний вид этого нивального миксомицета представлен на Рис. 16 А. В отличие от предыдущего вида, капиллиций данной формы имеет спиралевидные изгибы нитей (Рис. 16 Б), но отличается от сходного с ним D. pseudodecipiens ad int. значительно меньшим размером спор (10,5–11,5 мкм и 14–16 мкм диам. соответственно). До сих пор этот таксон не имеет формального описания [175].

Рис. 16. Didymium dubium f. spiralis LE285846. А – плазмодиокарп, Б – капиллиций и споры.

Lamproderma aeneum Mar. Mey. & Poulain; (И, 20); СЗ.Кав. (И, 5); Вал. (15); БСК: 1, АЛПа: 1, АЛПб: 3, ЕЧ: 15; живые растения: 15, опад: 5 (ПП: 80, 86, 87, 93, 100, 103, 106).

Характерными признаками данного вида являются медный оттенок в окраске перидия (Рис. 17 А) и довольно плотный темно-коричневый капиллиций (Рис. 17 Б, В), а также маленькие, 9,5–11 мкм диам., споры, орнаментированные мелкими бородавками (Рис. 17 Г).

Морфологические признаки спорокарпов из нашей коллекции хорошо согласуются с описанием в литературе [175]. Все пять последовательностей с Северо-Западного Кавказа представляют один генотип, идентичный последовательностям, полученным из Французских Альп (JQ031969) и Японии (JQ031970).

Lamproderma album H. Neubert, Nowotny & Baumann; (И, 10); СЗ.Кав. (М, 10); АЛПб: 2, АЛПа: 8; опад: 10 (ПП: 82, 89, 96, 97).

Ключевым признаком данного вида является комбинация почти белого капиллиция, прозрачного под микроскопом (Рис. 17 Д), и крупной ножки (Рис. 17 Е); последний признак отличает его от L. pulchellum Meyl. [151, 210]. Ладо [102] считает данный вид синонимичным L. splendens Meyl. Две полученные последовательности идентичны таковой из Французских Альп (JQ031971).

Lamproderma arcyrioides (Soммerf.) Rostaf.; (М, 31); Хиб. (И, 8); СЗ.Кав. (И, 8); Лен. (Ч, 13); Валаам (2); БС: 6, АТ: 2, БСК: 1, АЛПа: 5, АЛПб: 2, ЕЧ: 13, СЧ: 2; живые растения: 19, опад: 12; (ПП: 30–32, 68, 81, 87, 93, 100, 112).

Спорокарпы имеют голубоватый цвет с металлическим радужным блеском различного оттенка (Рис. 17 Ж), капиллиций светло-коричневый, формирует плотную сеть с нитями, утонченными на концах (Рис. 17 З, И), споры мелкобородавчатые (Рис. 17 К).

Шесть полученных последовательностей распадаются на два близких генотипа, ни один из которых не идентичен аналогичным последовательностям образцов из Французских Альп (JQ031973, JQ031977) и Италии (JQ031997).

Lamproderma cacographicum Bozonnet, Mar. Mey. & Poulain; (Р, 2); Хиб. (Р, 1); СЗ.Кав.

(Р, 1); АТ: 1, БСК: 1; живые растения: 2 (ПП: 32, 80).

Почти сидячие спорокарпы (Рис. 17 Л), плотный сетчатый капиллиций с уплощенными нитями (Рис. 17 М) и необычная орнаментация спор в виде отдельных слабоветвящихся низких ребер, которые под световым микроскопом выглядят как темные штрихи (Рис. 17 Н, О), – уникальная комбинация морфологических признаков данного вида.

Lamproderma cristatum Meyl.; (Р, 1); СЗ.Кав. (Р, 1); БСК: 1; живые растения: 1 (ПП: 80).

Этот редкий вид характеризуется сидячими или на коротких ножках спорокарпами (Рис. 17 П), красно-коричневым капиллицием с прозрачными окончаниями (Рис. 17 Р, С) и орнаментацией спор в виде коротких ребер из слившихся бородавок (Рис. Т, У).

Единственная полученная последовательность идентична последовательности образца из Французских Альп (JQ031977).

Lamproderma cucumer (Meyl.) Nowotny; (Р, 2); СЗ.Кав. (Р, 2); АЛПб: 2; опад: 2 (ПП: 89).

Спорокарпы на коротких ножках, почти цилиндрические или овально-вытянутые (Рис.

17 Ф), плотный капиллиций со светлыми окончаниями (Рис. 17 Х) и бородавчатые споры (Рис. 17 Ц, Ч) являются отличительными признаками данного вида.

Две полученные последовательности идентичны друг другу, при этом они отличаются от аналогичных последовательностей образцов L. ovoideum и L. ovoideoechinulatum, но попадают с ними в одну кладу.

Рис. 17. Морфология нивальных видов р. Lamproderma. А – спорокарп, Б – вид колонки, В – капиллиций и споры (SEM), Г – фрагмент орнаментации споры L. aeneum LE285899 (SEM).

Д – спорокарп, Е – капиллиций и споры L. album LE285204. Ж – спорокарпы, З – вид колонки, И – капиллиций (SEM), К – фрагмент орнаментации споры L. arcyrioides LE285897 (SEM). Л – спорокарп, М – капиллиций (SEM), Н – споры, O – характер орнаментации L.

cacographicum LE285755 (SEM). П – спорокарпы, Р – вид колонки, C – капиллиций (SEM), Т

– споры, У – характер орнаментации споры L. cristatum LE285764 (SEM). Ф – спорокарпы, Х

– капиллиций (SEM), Ц – споры, Ч– характер орнаментации споры L. cucumber LE285263 (SEM). Линейка: А, Д, Ж, Л, П, Ф – 1 мм; Е, Р – 100 мкм; Б, В, З, И, М, Н, С, Т, Х, Ц – 10 мкм; Г, К, О, У, Ч – 1 мкм.

Lamproderma echinosporum Meyl.; (И, 15); СЗ.Кав. (М, 15); БСК: 6, АЛПа: 7, АЛПб: 2;

живые растения: 11, опад: 4 (ПП: 80, 82, 86, 87).

Перидий с темными пятнами (Рис. 18 А), плотный капиллиций (Рис. 18 Б) и крупные споры 12–16 мкм диам. (Рис. 18 В) с довольно длинными шипами до 1 мкм (Рис. 18 Г) представляют типичные признаки этого вида.

Семь полученных последовательностей сходны между собой и распадаются на три генотипа, один из которых идентичен образцу из Японии (JQ031979), а другой – образцу из Швейцарии (JQ031980).

Lamproderma kowalskii A. Ronikier, Lado & Mar. Mey.; (Р, 2); Хиб. (Р, 2); БС: 2; живые растения: 1, опад: 1 (ПП: 4, 8).

Изначально два найденных образца были идентифицированы как два разных вида: L.

argenteobrunneum A. Ronikier, Lado & Mar. Mey. [184] и L. kowalskii. После тщательного повторного исследования, а также консультаций с А. Роникер было решено отнести оба образца к L. kowalskii [47]. Наши образцы отличаются от типового описания только меньшим размером спор, (8–) 8,9–9,5 (–10,5) мкм диам. Спорокарпы на ножках, с маленькими пятнышками в основании споротеки (Рис. 18 Д). Колонка достигает центра споротеки (Рис.

18 Е). Капиллиций сетчатый, образует расширения в местах ветвления (Рис. 18 Ж). Споры в массе коричневые, размер спор варьирует от 8,9 до 10,5 мкм диам. (Рис.З, И), орнаментация спор в виде маленьких рассеянных шипиков, никогда не образующих сеточку (Рис. 18 К, Л).

Lamproderma maculatum Kowalski; (И, 14); Хиб. (И, 4); СЗ.Кав. (М, 10); БС: 4, БСК: 6, АЛПа: 3, АЛПб: 1; живые растения: 4, опад: 10 (ПП: 33, 57, 78, 80, 82).

Спорокарпы данного вида морфологически сходны с L. echinosporum и отличаются только удлиненной ножкой (Рис. 18 М, Н). Капиллиций с многочисленными свободными окончаниями (Рис. 18 О), споры бородавчатые (Рис. 18 П, Р). Генетически эти виды, однако, хорошо отличаются друг от друга [158].

Единственная полученная нами последовательность идентична последовательности образца из Французскиз Альп (JQ031982).

Lamproderma maculatum var. macrosporum Mar. Mey., G. Morenо, A. Sanchez, H. Singer & Illana; (Р, 5); Хиб. (И, 5); БС: 5; живые растения: 4, опад: 1 (ПП: 8, 16, 17).

По внешнему виду спорокарпы (Рис. 18 С) похожи на спорокарпы предыдущего вида, однако споры этой разновидности имеют значительно больший размер, (15–) 16–18,5 (–20) мкм диам. (Рис. 18 Т, У). Орнаментация спор (Рис. 18 Ф) фактически идентична таковой L.

maculatum. Разновидности с увеличенным размером спор по сравнению с основной формой известны для многих видов родов Lamproderma и Meriderma [175]. Следует подчеркнуть, что эти формы отличаются не только большим размером спор, но и значительно более выраженным варьированием их размера. Таким образом, для подтверждения правомочности выделения этих форм необходим молекулярно-генетический анализ. В роде Meriderma «макроспоровая» форма представляет отдельный генотип (см. ниже).

Lamproderma ovoideum Meyl.; (М, 35); Хиб. (Р, 3); СЗ.Кавказ (Ч, 32); БС: 3, БСК: 5, АЛПа: 2, АЛПб: 25; живые растения: 6, опад: 29 (ПП: 9, 33, 77, 80, 82, 83, 87, 89, 90, 91, 93, 96–98).

Это один из наиболее массовых видов рода на Северо-Западном Кавказе. Его отличительными признаками являются обратнояйцевидные спорокарпы на короткой ножке (Рис. 18 Х), плотный капиллиций (Рис. 18 Ц) и шипиковая орнаментация спор (Рис. 18 Ч).

Получено двенадцать последовательностей, распадающихся на семь генотипов, сходных (но не идентичных) с последовательностями из Франции (DQ903675) и Японии (DQ031984).

Lamproderma pseudomaculatum Mar. Mey. & Poulain; (Р, 3); Хиб. (Р, 2); СЗ.Кавказ (Р, 1); БС: 2, АЛПб: 1; опад: 3 (ПП: 17, 89).

Этот вид отличается довольно крупными спорокарпами на коротких ножках (Рис. 18

Ш) и розовато-коричневыми нитями капиллиция с бесцветными окончаниями в проходящем свете (Рис. 18 Э). Споры орнаментированы крупными рассеянными бородавками (Рис. 18 Ю).

Lamproderma pulchellum Meyl.; (И, 9); Хиб. (Р, 1); СЗ.Кавказ (И, 8); БС: 1, БСК: 3, АЛПа: 3, АЛПб: 2; живые растения: 1, опад: 8 (ПП: 8, 82, 83, 89).

Спорокарпы этого вида собраны группами (Рис. 19 А), 1–1,4 мм диам., ножка присутствует редко. Капиллиций сетчатый, плотный, встречаются анастомозы; споры темнокоричневые, 10,5–13,5 мкм диам. (Рис. 19 Б).

Единственная полученная нами последовательность значительно отличается от последовательности образца того же вида из Франции (JQ031987).

Рис. 18. Морфология нивальных видов р. Lamproderma. А – спорокарпы, Б – капиллиций (SEM), В – споры, Г – фрагмент орнаментации споры L. echinosporum LE285732 (SEM). Д – спорокарпы, Е – вид колонки, Ж – расширения капиллиция (SEM), З – спора, И – поверхность споры, К – характер орнаментации споры (SEM), Л – фрагмент орнаментации споры Lamproderma kowalski LE289778 (SEM). М – спорокарпы, Н – вид колонки, O – капиллиций (SEM), П – споры, Р – фрагмент орнаментации споры L. maculatum LE285708 (SEM). C – спорокарпы, Т – поверхность споры, У –спора, Ф – фрагмент орнаментации споры L. maculatum var. macrosporum LE289799 (SEM). Х – спорокарп, Ц – капиллиций (SEM), Ч – фрагмент орнаментации споры L. ovoideum LE285772 (SEM). Ш – спорокарп, Э – капиллиций, Ю – спора L. pseudomaculatum LE289959 (SEM). Линейка: Х, Ш – 1 мм; А, Д, М, С – 500 мкм; Н – 200 мкм; Б, О, Ц, В, Е, П, Э – 10 мкм; Ж, З, И, Ю – 3 мкм; Г, К, Л, Р, Т, У, Ф

– 1 мкм.

Lamproderma pulveratum Mar. Mey. & Poulain; (Ч, 62); Хиб. (Ч, 37); СЗ.Кавказ (Ч, 25);

АТ: 1, БС: 36, АЛПб: 7, АЛПа: 14, БСК: 4; живые растения: 25, опад: 37 (ПП: 9, 10, 16, 17, 30, 31, 33, 70, 80, 82, 86, 87, 90, 93).

Это один из массовых видов как на Северо-Западном Кавказе, так и в Хибинах. Все наши образцы имеют перидий, инкрустированный белыми иголочками извести (Рис. 19 В).

Капиллиций плотный (Рис. 19 Г, Д), споры бородавчатые с рассеянной орнаментацией (Рис.

19 Е, Ж).

Тринадцать последовательностей с Северо-Западного Кавказа идентичны между собой и с последовательностью образца из Франции (JQ031988).

Lamproderma sauteri Rostaf.; (Ч, 48); Хиб. (М, 21) СЗ.Кавказ (Ч, 26); Вал. (1); БС: 3 АТ:

18, БСК: 16, АЛПа: 3, АЛПб: 7, ЕЧ: 1; живые растения: 12, опад: 36 (ПП: 8, 17, 20, 23, 24, 32, 33–34, 63, 68, 70, 78, 80, 82, 89, 97, 100).

Данный вид наиболее близок по своей морфологии к L. echinosporum Meyl. Оба вида имеют довольно крупные спорокарпы, 1–2 мм диам., на относительно короткой ножке до 1/3 от общей длины спорокарпа (Рис. 19 З). Перидий имеет слабо выраженный радужный блеск и, в отличие от L. echinosporum, не имеет темных пятен. Капиллиций формирует довольно плотную сеть из темно-коричневых нитей (Рис. 19 И). Споры, в отличие от L. echinosporum, густо орнаментированы шипиками не более 0,5 мкм длин. (Рис. 19 К) [92].

Пять последовательностей, полученных из образцов с Северо-Западного Кавказа, относятся к трем значительно отличающимся друг от друга генотипам. Один из них, представленный тремя образцами, идентичен образцу L. sauteri из Франции (DQ903674), однако морфологически этот образец сходен с L. pulchellum из нашей кавказской коллекции.

Четвертый образец, LE285275, имеет сходный генотип с образцом, морфологически определенным как L. pulchellum (JQ812672); пятый образец, LE285199, идентичен генотипически образцам L. echinosporum. Столь высокое генетическое разнообразие в пределах одного вида указывает на необходимость тщательного морфологического и молекулярного анализа близких видов и ревизии данного таксона.

Lamproderma sauteri var. atrogriseum Meyl.; (Р, 2); СЗ.Кавказ (Р, 2); АЛПа: 2; опад: 2 (ПП: 82).

Морфологически эта разновидность отличается от основной формы серо-стальной окраской перидия (Рис. 19 Л). Остальные признаки сходны с признаками основной формы (Рис. 19 М–О).

Получены две сильно различающиеся между собой последовательности, одна (JQ812671, LE285206) принадлежит образцу, морфологически сходному с L. sauteri, тогда как другая (JQ812677, LE285213) – образцу, сходному с L. echinosporum.

Lamproderma spinulisporum Mar. Mey., Nowotny & Poulain; (М, 33); Хиб. (Р, 1);

СЗ.Кавказ (Р, 2); Лен. (Ч, 26); Вал. (4); БС: 1, БСК: 1, АЛПб: 1, ЕЧ: 29, СЧ: 1; живые растения: 25, опад: 8 (ПП: 51, 80, 89, 100, 103, 108, 110, 112).

Образцы из всех изученных районов имеют сходную морфологию сидячих или на коротких ножках спорокарпов (Рис. 19 П), а также орнаментацию спор в виде длинных шипиков высотой 0,3–0,7 мкм (Рис. 19 Р).

Lamproderma zonatum Mar. Mey. & Poulain; (Р, 1); Вал. (1); ЕЧ: 1; живые растения: 1 (ПП: 100).

Спорокарпы сидячие, элипсовидные, 0,5–1,5 мм выс., голубые с бронзовым отливом в виде отдельных более темных широких полос (Рис. 19 С). Колонка от 1/2 до 2/3 от общей высоты споротеки. Капиллиций плотный, с тонкими нитями на периферии. Споры коричневые различных оттенков, (10,5–) 11–13,5 (–14) мкм диам., густо орнаментированы бородавками (Рис. 19 Т).

Lepidoderma aggregatum Kowalski; (И, 14); Хиб. (И, 4); СЗ.Кавказ (М, 10); БС: 3, АТ: 1, БСК: 1, АЛПб: 9; опад: 14 (ПП: 24, 68, 80, 96–98).

Наши образцы по своей морфологии хорошо подходят под описания в литературе [93, 103, 164, 175] и представлены короткими плазмодиокарпами с двухслойным перидием, покрытым чешуйками извести (Рис. 20 А). Споры и капиллиций типичны для этого вида (Рис. 20 Б). Морено и др. [141] рассматривает этот вид в качестве синонима L. chailletii Rostaf. С другой стороны, французские авторы [173], так же как и Ладо [103], считают L.

aggregatum валидным таксоном и различают эти два вида по числу слоев перидия: L.

chailletii имеет один слой, тогда как перидий L. aggregatum двухслойный (внутренний пленчатый слой отделен от наружного, покрытого кальцинированными чешуйками).

Lepidoderma aggregatum var. niveum Poulain, Mar. Mey & Bozonnet; (Р, 2); СЗ.Кавказ (Р, 2); АТ: 2; опад: 2 (ПП: 97).

Данная разновидность отличается от основной только более светлой окраской спорокарпов (Рис. 20 В) и инкрустированным редкими чешуйками соединений кальция внутренним слоем перидия.

Рис. 19. Морфология нивальных видов р. Lamproderma. А – спорокарпы, Б – капиллиций и споры L. pulchellum LE285298. В – спорокарпы, Г – вид колонки, Д – капиллиций (SEM), Е – споры, Ж – фрагмент орнаментации споры L. pulveratum LE285692 (SEM). З – спорокарпы, И

– капиллиций (SEM), К – характер орнаментации споры L. sauteri LE285253 (SEM). Л – спорокарпы, М – капиллиций (SEM), Н – споры, O – характер орнаментации споры L. sauteri var. atrogriseum LE285206 (SEM). П – спорокарпы, Р – фрагмент орнаментации споры L.

spinulisporum LE299928 (SEM). C – спорокарп, Т – спора L. zonatum LE285518 (SEM).

Линейка: В – 2 мм; А – 1 мм; З, Л, П, С – 500 мкм; И – 50 мкм; Б, Д, М – 20 мкм; Г, Е, Н – 10 мкм; Ж, К, О, Р, Т – 1 мкм.

Lepidoderma alpestroides Mar. Mey. & Poulain; (Р, 1); Хиб. (Р, 1); АТ: 1; опад: 1 (ПП: 63).

–  –  –

Lepidoderma carestianum (Rabenh.) Rostaf.; (М, 32); Хиб. (Р, 1); СЗ.Кавказ (М, 13); Лен.

(Ч, 18); АТ: 1, АЛПа: 3, АЛПб: 10, ЕЧ: 18; живые растения: 5, опад: 27 (ПП: 31, 82, 90, 91, 96, 97, 100).

Наши образцы хорошо согласуются с описанием данного вида (Рис. 20 З–К). Однако в литературе нет единого мнения относительно валидности этого таксона. Ковальский в своей монографии предположил, что этот вид конспецифичен L. chailletii [96]. Но дальнейшие исследования типового материала показали, что оба вида сильно отличаются друг от друга [173]. У L. carestianum спорокарпы представлены плазмодиокарпами (Рис. 20 З), у L. chailletii (Рис. 20 Н) – спорангиями. Кроме того, они хорошо отличаются по числу слоев перидия, структуре капиллиция и орнаментации спор. Ладо и Роникиер [103] считают, что L.

carestianum морфологически ближе к L. granuliferum, чем к L. chailletii. L. granuliferum формирует плазмодиокарпы и имеет отложения соединений кальция в виде узелков в структуре капиллиция (Рис. 20 Р). Эти авторы подчеркивают, что имеется множество переходных форм с разной степенью обызвествления капиллиция, и считают, что L.

granuliferum конспецифична L. carestianum.

–  –  –

Lepidoderma carestianum f. granulosum ad int.; (И, 15); Хиб. (И, 8); СЗ.Кавказ (И, 7); БС:

5, АТ: 3, АЛПб: 7; живые растения: 3, опад: 12 (ПП: 18, 31, 45, 62, 68, 87, 93, 97).

Все собранные образцы состоят из нескольких крупных плазмодиокарпов (Рис. 20 Л).

Капиллиций представлен рыхлой губковидной сеткой с многочисленными обызвествленными узелками (Рис. 20 М). Мы считаем данную форму синонимичной L.

однако необходимы дальнейшие тщательные морфологические и granuliferum, молекулярные исследования для решения этого вопроса.

Рис. 20. Морфология нивальных видов р. Lepidoderma. А – плазмодиокарпы, Б – капиллиций и споры L. aggregatum LE285260. В – плазмодиокарпы L. aggregatum var. niveum LE296705. Г

– плазмодиокарп, Д – капиллиций, Е – споры и капиллиций (SEM), Ж – фрагмент орнаментации споры L. alpestroides LE297192 (SEM). З – плазмодиокарп, И – кальцинированная чешуйка на поверхности перидия (SEM), К – спора L. carestianum LE285864 (SEM). Л – плазмодиокарп, М – капиллиций и споры L. carestianum f. granulosum LE285889. Н – спорангии, O – капиллиций и споры, П – характер орнаментации споры L.

chailletii LE297215 (SEM). Р – узелки в структуре капиллиция L. granuliferum LE296718. C – спорокарпы, Т – капиллиций и споры L. peyerimhoffii LE285700. Линейка: А – 2 мм; В, Г, З, Л, Н, С – 1 мм; О, Р, Т – 20 мкм; Б, Д, Е, И – 10 мкм; М – 5 мкм; Ж, К, П – 1 мкм.

Lepidoderma chailletii Rostaf.; (М, 39); Хиб. (М, 16); СЗ.Кавказ (М, 9); Лен. (Ч, 10); Вал.

(4); БС: 14, АТ: 2, АЛПа: 4, АЛПб: 5, ЕЧ: 13, СЧ: 1; живые растения: 25, опад: 14 (ПП: 4, 8, 19, 55, 65, 82, 91, 96, 97, 100, 108, 112, 113).

См. комментарии к L. carestianum. Характерные признаки вида – спорангиальный тип спорокарпов (Рис. 20 Н), многовершинные шипики на поверхности спор (Рис. 20 О), а также отсутствие обызвествленных узелков в нитях капиллиция (Рис. 20 П).

Единственная последовательность образца с Северо-Западного Кавказа очень сходна с таковыми из Японии (Kamono, персон. сообщение) и Франции (штамм FR K-18, HE614609), однако последний образец впоследствии был определен как L. carestianum.

Lepidoderma granuliferum (W. Phillips) R. E. Fr.; (Р, 6); СЗ.Кавказ (И, 6); АЛПб: 6, опад:

6 (ПП: 96).

См. комментарии к видам L. aggregatum и L. carestianum. Ключевыми признаками данного вида являются плазмодиокарпоидный тип спорокарпов и обызвествленные узелки в структуре капиллиция (Рис. 20 Р).

Lepidoderma peyerimhoffii Maire & Pinoy; (И, 11); СЗ.Кавказ (М, 11); АЛПб: 7, АЛПа: 3, БСК: 1; опад: 11 (ПП: 82, 83, 86, 87, 89, 93, 96, 98).

Спорокарпы этого вида напоминают спорокарпы D. fallax (Рис. 20 С), однако шипики спор значительно короче, чем у последнего вида, и капиллиций несет более выраженные узелки (Рис. 20 Т).

Единственная последовательность образца c Северо-Западного Кавказа образует общий кластер c аналогичными последовательностями D. fallax.

Meriderma Mar. Mey. & Poulain.

Таксономия этого недавно выделенного из р. Lamproderma и сложного в систематическом отношении рода до настоящего времени представляет собой проблему, для решения которой необходимо привлечение молекулярных методов. В частности, на Кавказе нами было выявлено 10 генотипов. Несмотря на то, что последовательности консервативной части у видов р. Meriderma имеют значительное сходство с последовательностями образцов из Франции, один из наиболее часто встречающихся генотипов (JQ812650, 23 последовательности) идентичен последовательности образца из Японии (Kamono, персон.

сообщ.). Морфологически образцы этого распространенного генотипа наиболее сходны с морфовидами M. carestiae (11 образцов), M. carestiae var. retisporum (1 образец), M.

cribrarioides (2 образца) и M. echinulatum (9 образцов). Дальнейшая ревизия рода должна проводиться с учетом этих данных.

Meriderma aggregatum ad int.; (И, 14); Хиб. (Р, 2); СЗ.Кавказ (М, 9); Лен. (Р, 2); Вал. (1);

БС: 2, БСК: 1, АЛПб: 8, ЕЧ: 2, СЧ: 1; живые растения: 4, опад: 10 (ПП: 10, 30, 80, 97, 98, 104, 111).

В отличие от других видов р. Meriderma, спорокарпы этого вида сидячие, темнокоричневые (Рис 21 А). Споры 12–15 мкм диам., орнаментированы шипиками (Рис. 21 Б).

Единственная полученная нами последовательность с Северо-Западного Кавказа (JQ812658, LE285283) отличается от всех других последовательностей рода и очень сходна с последовательностью образца из Франции (DQ903669).

Meriderma aggregatum f. macrosporum ad. int.; (Р, 6); Вал. (6); ЕЧ.: 6; живые растения: 6 (ПП: 104, 105).

Эта форма отличается от основной более крупными спорами: 15–22 мкм диам. против 11–13 мкм диам. (Рис. 21 В).

Meriderma carestiae (Ces. & de Not.) Mar. Mey. & Poulain; (Ч, 56); СЗ.Кавказ (Ч, 27);

Лен. (Ч, 22); Вал. (7); БСК: 5, АЛПа: 20, АЛПб: 2, ЕЧ: 24, СЧ: 5; живые растения: 43, опад: 13 (ПП: 80, 86, 96, 100, 103–105, 110–113).

Это один из самых часто встречающихся нивальных видов рода на исследованных территориях, кроме Хибин. У этого вида значительно варьируют размер и соотношение длины ножки и споротеки, а также орнаментация спор [175]. В целом спорокарпы образцов из нашей коллекции довольно хорошо соответствуют типовому описанию (Рис. 21 Г, Д). В орнаментации спор этого вида преобладают шипики до 1мкм выс., которые иногда сливаются, формируя незамкнутую сеточку (Рис. Е, Ж).

Meriderma carestiae var. retisporum ad int.; (И, 10); Хиб. (Р, 1); СЗ.Кавказ (И, 3); Вал.

(6); БС: 1, БСК: 1, АЛПа: 1, АЛПб: 1, ЕЧ: 6; живые растения: 7, опад: 3 (ПП: 2, 80, 89, 100, 103).

Эта форма имеет спорокарпы на короткой ножке (Рис. 21 З), хорошо развитые воронковидные окончания нитей капиллиция (Рис. 21 И) и сетчатую орнаментацию спор, в которой, в отличие от предыдущего вида, имеются замкнутые ячейки (Рис. 21 К, Л).

Meriderma cribrarioides (Fr.) Mar. Mey. & Poulain; (Р, 6); СЗ.Кавказ (И, 6); АЛПа: 1, АЛПб: 5; опад: 6 (ПП: 87, 89).

Внешне спорокарпы этого вида (Рис. 21 М) напоминают таковые M. carestiae, однако споры имеют совершенно иную орнаментацию в виде сеточки с замкнутыми ячейками, высота стенок которых достигает 2 мкм (Рис. 21 Н).

Meriderma echinulatum (Meyl.) Mar. Mey. & Poulain; (М, 31); Хиб. (И, 8); СЗ.Кавказ (Ч, 18); Лен. (М, 4); Вал. (1); БС: 8, БСК: 7, АЛПа: 4, АЛПб: 7, ЕЧ: 4, СЧ: 1; живые растения: 18, опад: 13 (ПП: 20, 33, 35, 55, 56, 80, 82, 83, 87, 93, 100, 104, 112).

Ножки у спорокарпов этого вида развиты слабо или полностью отсутствуют (Рис. 21 О). Споры орнаментированы крупными, неравномерно распределенными шипиками (Рис. 21 П), которые иногда сливаются между собой (Рис. 21 Р).

Meriderma fuscatum (Meyl.) Mar. Mey. & Poulain; (Р, 1); Хиб. (Р, 1); БС: 1; живые растения: 1 (ПП: 68).

Единственный образец (LE48321) этого вида был найден в 1994 г. [164] и был зарегистрирован как Lamproderma cf. fuscatum Meyl. К сожалению, спорокарпы в данном образце оказались слишком сильно разрушены, чтобы провести повторное исследование.

Meriderma spinulosporum ad int.; (М, 27); Хиб. (М, 17); СЗ.Кавказ (И, 3); Вал. (7); БС:

13, АТ: 4, АЛПа: 2, АЛПб: 1, ЕЧ: 7; живые растения: 20, опад: 7 (ПП: 8, 30, 32, 51, 52, 56, 68, 70, 97, 100, 104, 105).

Этот вид, так же как и M. carestiae, имеет спорокарпы с длинными ножками (Рис. 21 С), но отличается от последнего более крупными шипиками в орнаментации спор (Рис. 21 Т).

Размеры спор сильно варьируют. Например, в Хибинах нами были выделены три морфотипа [47]. Группа 1 (LE296847, LE296936, LE296971, LE296972, LE296987, LE297123, LE297126, LE297130, LE297139, LE297140, LE297141) имеет споры 13,4±1,4 мкм диам.

(сред. ариф. ± стандартное отклонение, обсчитано 299 спор). Эта группа хорошо соответствует морфотипу, описанному в литературе как “f. spinuloporum” [175]. Группа 2 (LE289772, LE289788, LE296977, LE296982, LE297133, LE297161) имеет очень большие споры, 15,6 ± 1,1 мкм диам. (115 спор) и соответствует “f. macrosporum”. Наконец, группа 3 представлена одним образцом (LE297160) с гигантскими спорами 22,5 ± 1,9 мкм диам. и сидячими спорокарпами и может быть отнесена к “f. gigasporum” [175]. Образец LE297141 представлен уникальным генотипом (KM186974), который отличается от всех других, известных для M. spinulosporum.

Meriderma spinulosporum f. gigasporum ad int.; (Р, 2); Хиб. (Р, 1); СЗ.Кавказ (Р, 1); БС:

1, АЛПа: 1; живые растения: 2 (ПП: 56, 85).

Отличается от основной формы только гигантскими размерами спор: (20,5–) 22,5 (– 24,5) мкм диам (Рис. 21 У).

Рис. 21. Морфология нивальных видов р. Meriderma. А – спорокарпы, Б – споры M.

aggregatum LE285283. В – споры M. aggregatum f. macrosporum LE289612. Г – спорокарп, Д – вид колонки, Е – окончания капиллиция, Ж – фрагмент орнаментации споры Meriderma carestiae LE285693 (SEM). З – спорокарпы, И – капиллиций и споры (SEM), К – споры, Л – характер орнаментации споры M. carestiae var. retisporum LE285280 (SEM). М – спорокарпы, Н – сетчатая орнаментация споры Meriderma cribrarioides LE285847 (SEM). O –спорокарпы, П – споры, Р – характер орнаментации споры M. echinulatum LE285798 (SEM). C – спорокарпы, Т – характер орнаментации споры M. spinulosporum LE285681 (SEM). У – споры M. spinulosporum f. gigasporum LE297160. Ф – спорокарпы, Х – расширения на концах нитей капиллиция (SEM), Ц – споры, Ч – характер орнаментации споры Meriderma verrucosporum LE285227 (SEM). Линейка: Г – 2 мм; А, З, М, О, С, Ф – 1 мм; Д – 100 мкм; Б, В, Е, И, К, П, У, Х, Ц – 10 мкм; Ж, Л, Н, Р, Т, Ч – 1 мкм.

Meriderma verrucosporum ad. int.; (Р, 3); СЗ.Кавказ (И, 3); АЛПа: 2, АЛПб: 1; опад: 3 (ПП: 82, 96).

Этот вид имеет спорокарпы на длинных ножках (Рис. 21 Ф) и хорошо развитые воронковидные окончания нитей капиллиция (Рис. 21 Х). Отличается от других видов рода бородавчатыми спорами (Рис. 21 Ц, Ч).

Physarum albescens Ellis ex T. Macbr.; (Ч, 237); Хиб. (Ч, 231); СЗ.Кавказ (И, 6); БС: 164, АТ: 67, БСК: 2, АЛПа: 1, АЛПб: 3; живые растения: 160, опад: 77 (ПП: 2, 8–10, 12–21, 23–26, 28–32, 35, 41, 44–46, 48, 51, 53, 55–59, 61, 63, 70, 80, 82, 89, 90).

Отличается от других нивальных видов р. Physarum полушаровидной или яйцевидной формой споротеки, гипоталлусом в виде ножкообразного пленчатого выроста (Рис. 22 А) и неравномерной желто-оранжевой окраской соединений кальция на поверхности перидия (Рис. 22 Б). У спорокарпов с недостаточным содержаним кальция в перидии окраска становится темно-голубой с радужным отливом, в результате чего они напоминают плодовые тела некоторых видов Lamproderma (Рис. 22 В). Довольно маленькие желтоватые узелки нитей капиллиция, а также орнаментированные шипиками споры 11–13 мкм диам., более светлые на одной из сторон, – характерные микроскопические призаки данного вида (Рис. 22 Г). В Хибинах этот вид является супердоминантом [47].

Анализ четырех последовательностей образцов с Северо-Западного Кавказа позволил выделить три генотипа. Полученные последовательности хотя и не абсолютно идентичны, но очень похожи на последовательности того же вида из Британской Колумбии (JQ812639), Австрии (JQ812636) и Франции (Fiore-Donno, неопубл.) [158].

Physarum alpestre Mitchel, S. W. Chapm. & M. L. Farr; (М, 40); СЗ.Кавказ (Ч, 40); БСК:

1, АЛПа: 1, АЛПб: 38; живые растения: 1, опад: 39 (ПП: 78, 80, 82, 87, 89, 91, 96–98).

Ключевыми признаками данного вида [139] являются двухслойный перидий с гладким наружным слоем (Рис. 22 Д) и маленькие, 10–11 мкм диам., бородавчатые споры (Рис. 22 Е).

Наши образцы хорошо подходят под типовое описание данного вида.

Единственная полученная последовательность (JQ81268, LE285223) явно отличается от последовательности образца Ph. alpinum (JQ812679, LE285134).

Physarum alpinum (Lister & G. Lister) G. Lister; (И, 10); СЗ.Кавказ (М, 10); БСК: 1, АЛПа: 3, АЛПб: 6; живые растения: 2, опад: 8 (ПП: 80, 82, 87, 89, 91, 96).

Наша коллекция представлена желтоватыми сидячими спорокарпами (Рис. 22 Ж), споры имеют плотную бородавчатую орнаментацию (Рис. 22 З).

Полученная нами последовательность (JQ812679) пока является единственной в GenBank.

Physarum nivale (Meyl.) Mar. Mey. & Poulain; (И, 13); СЗ.Кавказ (М, 13); АЛПа: 3, АЛПб: 10; опад: 13 (ПП: 82, 88, 89, 91, 93).

В соответствии с описанием французских авторов [175], мы отделяем этот вид от P.

vernum. Его отличительными признаками являются: 1) сероватый оттенок в цвете перидия (Рис. 22 И), 2) хорошо развитый бадамиоидный тип капиллиция (т.е. без явной дифференциации на нити и узелки) с плотно упакованными гранулами, содержащими соединения кальция, 0,5–2 мкм диам., в крупных многоугольных узелках (Рис. 22 И), 3) темная споровая масса (brBlack 65, Brownish Black) [28], 4) несколько более темные на просвет споры, чем у Ph. vernum, 5) плотная орнаментация спор бородавками (Рис. 22 К).

Из образцов с Кавказа получено шесть последовательностей гена, все они идентичны образцу из Британской Колумбии, который ранее был определен как Ph. nivale (Schnittler, личное сообщение, sc9292). После консультаций с авторами таксона и тщательного сравнения с другими коллекциями многие образцы, ранее определенные как Ph. vernum, были переопределены как Ph. nivale. Следует отметить, что оба вида практически неотличимы в полевых условиях, однако их последовательности ясно отличаются между собой [158].

Physarum vernum Soммerf.; (М, 41); СЗ.Кавказ (Ч, 39); Лен. (Р, 2); БСК: 6, АЛПа: 11, АЛПб: 22, ЕЧ: 2; живые растения: 3, опад: 38 (ПП: 77, 80, 82, 86, 87, 89–91, 96, 97, 102).

Все изученные образцы явно отличаются от Ph. nivale несколькими ключевыми признаками: 1) обилие кальция в наружном слое перидия делает его белоснежным, толстым и гладким (Рис. 22 Л), 2) маленькие узелки капиллиция несут по своим краям менее плотно упакованные и лучше различимые в проходящем свете гранулы с кальцием, 1–3 мкм диам.

(Рис. 22 Н), 3) цвет споровой массы коричневый (m.Br 58 Moderate Brown or d.Br 59 Dark Brown) [28] (Рис. 22 О). Недоразвитие перидия приводит к формированию спорокарпа, схожего с плодовыми телами р. Lamproderma (Рис. 22 М). Орнаментация спор представлена крупными и короткими бородавками с уплощенными вершинами (Рис. 22 П).

Шестнадцать полученных последовательностей формируют пять генотипов, один из которых оказывается идентичным таковому из Австрийских Альп (sc18491, sc18528, sc18555). Такая генетическая неоднородность отражает значительную морфологическую изменчивость признаков этого вида [103].

Рис. 22. Морфология нивальных видов р. Physarum. А – спорокарпы, Б – вид отложений кальция в капиллиции, В – пример слабо кальцинированного перидия, Г – споры Ph.

albescens LE285158. Д – плазмодиокарпы, Е – споры Ph. alpestre LE285852. Ж – плазмодиокарпы, З – споры Ph. alpinum LE285760. И – сидячие спорокарпы, К – споры Ph.

nivale LE285671. Л – общий вид плазмодиокарпов, М – перидий без отложений кальция, Н – вид узелков капиллиция, O – споры, П – характер орнаментации спор Ph. vernum LE285718 (SEM). Линейка: Л – 5 мм; И – 2 мм; А, Б, В, М – 1 мм; Д, Ж – 500 мкм; Н – 200 мкм; Г, Е, З, К, О – 10 мкм; П – 1 мкм.

Trichia alpina (R. E. Fr. ) Meyl.; (М, 26); Хиб. (М, 19); СЗ.Кавказ (И, 7); БС: 18, АТ: 1, БСК: 3, АЛПа: 2, АЛПб: 2; живые растения: 2, опад: 24 (ПП: 32, 68, 80, 82, 87, 96).

Все образцы с Северо-Западного Кавказа и из Хибин имеют почти черный цвет перидия (Рис. 23 А) и ярко-желтый цвет споровой массы (Рис. 23 Б). Тупоконечные нити капиллиция имеют типичную спиральную орнаментацию (Рис. 23 В).

Trichia sordida Johannesen; (Р, 4); СЗ.Кавказ (И, 4); АТ: 4; опад: 4 (ПП: 87, 89, 96, 97).

Этот довольно редкий вид отличается от предыдущего светло-коричневым цветом пленчатого перидия (Рис. 23 Г), а также размером и характером орнаментации капиллиция (Рис. 23 Д) и спор (Рис. 23 Е).

–  –  –

6.1 Видовое богатство и разнообразие сообществ нивальных миксомицетов в районах исследования На территории исследованных нами районов была собрана коллекция из 1455 гербарных образцов спорокарпов нивальных видов миксомицетов (Приложение 2).

В анализе данных нами также учитывались 17 регистрационных записей находок Physarum albescens из Хибин. Определение этого самого массового в Хибинах нивального вида не вызывало сложностей, поэтому с целью экономии времени и места мы не гербаризировали каждую найденную колонию спорокарпов, однако регистрировали все находки в базе данных. Кроме того, в том случае, когда принадлежность образцов к нивальным видам не вызывала сомнения, нами также регистрировались образцы спорокарпов, которые можно было определить только до уровня рода из-за плохой сохранности материала или плохого развития спорокарпов. Всего таких образцов было зарегистрировано 26 (т.е. 1,8 % от общего числа образцов в базе данных), все они включены в соответствующие разделы анализа таксономической структуры сообществ нивальных миксомицетов. К р. Diacheopsis был отнесен 1 образец, р. Diderma – 9, р. Didymium – 1, р Lamproderma – 12, р. Meriderma – 3.

На основании изучения нашей коллекции и образцов, собранных Ю.К. Новожиловым и М. Шниттлером [164], а также критического анализа списков видов, опубликованных после 1996 г. [15], на территории России нами было выявлено 46 видов и 9 внутривидовых таксонов нивальных миксомицетов, которые относятся к 9 родам, 4 семействам и 3 порядкам. Такое количество видов составляет 80,9 % от 68 всех известных нивальных видов и 15 % от 364 видов миксомицетов, отмеченных на территории России (Новожилов, персон.

данные). Тридцать девять видов найдены нами в России впервые.

В данной работе мы использовали морфологическую концепцию вида, поэтому, значительное число скрытых, или так называемых, криптических видов, возможно, не были учтены. В тексте диссертации термин «вид» используется как синоним морфовида, т.е. вида, основанного исключительно на морфологических признаках. Все исходные объемы таксонов и номенклатура были приведены к общей системе К. Ладо [102].

Как видно из графика кривой накопления видов, рассчитанной на основе максимального среднего значения индекса Chao1 (Рис. 24), нами была выявлена большая часть ожидаемых видов во всех исследованных районах: Chao1=56,67±2,59. Для гор число ожидаемых видов составляет Chao1=54,11±1,58; нами зарегистрировано 53 вида, а для равнинных ландшафтов Chao1=16,5±1,3; нами отмечено 16 видов, что также говорит о выявленности большинства нивальных видов в обоих типах местообитаний.

Рис. 24. Оценка выявления полного числа видов в районах исследования в зависимости от количества образцов. Тонкие линии показывают средние значения ожидаемого числа видов (индекс Chao1), толстые линии – кривые накопления числа видов в зависимости от числа выявленных образцов.

Сообщество нивальных миксомицетов Хибин Основной массив данных о нивальных миксомицетах был получен из районов с умеренным климатом, тогда как данные о нивальных миксомицетах субарктических и арктических районов крайне скупы. Б. Инг [79], обсуждая сходство сообществ миксомицетов Арктики, Европы и Америки, основывается на числе и встречаемости видов и делает вывод о том, что существуют две группы: альпийские и полярные миксомицеты. Однако доступные из литературы данные показывают, что миксомицеты, обычные в Арктике и Субарктике (напр., Leocarpus fragilis (Dicks.) Rostaf.), крайне редко встречаются в альпийских биотопах.

Напротив, виды, обычные в альпийских биотопах, не были найдены в таежных и лесотундровых равнинных биотопах высоких широт [107, 157, 162, 215, 216]. Тем не менее, некоторые данные указывают на то, что некоторые виды нивальных миксомицетов могут заходить далеко на север и встречаться в горных системах Субарктики и Арктики.

К началу наших исследований были опубликованы несколько аннотированных списков миксомицетов из Скандинавских гор [67, 68, 82, 83, 193].

Из этих работ следует, что в этом горном регионе отмечено 90 видов, среди которых только 9 относятся к нивальным видам:

Diderma alpinum, D. fallax, D. niveum, Lepidoderma carestianum, Meriderma carestiae, M.

cribrarioides, Physarum alpinum, Ph. vernum и Trichia alpina.

Первые исследования миксомицетов в Хибинах были проведены Ю.К. Новожиловым и М. Шниттлером [164]. Эти авторы зарегистрировали 40 видов из 18 родов; из них только 10 нивальных видов, отмеченных уже в тот период, когда их спороношение заканчивалось, что не позволило выявить большее число видов.

В результате наших исследований, проведенных на юго-восточных склонах Хибин, была собрана коллекция из 667 образцов спорокарпов, относящихся к 28 видам, 3 разновидностям и 2 формам из 8 родов и 5 семейств. Совместно с коллекцией, собранной в 1994 г. массив данных для анализа составил 716 образцов, включая 17 записей находок Ph.

albescens. Среди выявленных таксонов видового и внутривидового уровней 28 являются новыми для Хибин, 6 для России и 26 для Фенноскандии. Следует отметить, что нам не удалось найти повторно виды Diacheopsis effusa и Meriderma fuscatum, отмеченные в 1994 г.

Пятнадцать из 33 таксонов классифицированы как редкие (встречаемость 0,5 %).

Девять видов образуют ядро доминантов сообщества: Physarum albescens (231 образцов), Diderma alpinum (143), D. niveum (79), Lamproderma pulveratum (37), L. sauteri (34), Diderma meyerae (33), D. microcarpum (21), D. globosum var. europaeum (20), Trichia alpina (19), что вместе составляет 77,8 % от всего числа найденных образцов.

График накопления видов на Рис. 25 показывает, что нами была выявлена большая часть ожидаемых видов в регионе в целом (Chao1=34,2±4,3), а также в поясе березового криволесья (30 зарегистрированных таксонов против Chao1=22,0±3,4), тогда как видовой состав арктической тундры был изучен явно недостаточно (19 против Chao1=40,0±20,2).

Рис. 25. Оценка выявления полного числа видов в Хибинах в зависимости от количества образцов. Обозначения линий как на Рис. 24. БС – березовое криволесье, АТ – арктическая тундра.

Сообщество нивальных миксомицетов Хибин довольно бедно и насчитывает менее половины известных на Земле нивальных видов [181]. При этом видовое богатство и разнообразие уменьшается от березового криволесья (25 видов, 3 разновидности, 2 формы, 514 образцов; H=2,18, E=0,65, D=0,17) к альпийской тундре (17 видов, 1 разновидность, 1 форма, 202 образца; H=1,95, E=0,66, D=0,19).

Рис. 26. График рангового распределения видов нивальных миксомицетов Хибин в разных типах растительности. БС – березовое криволесье, АТ – арктическая тундра.

Наиболее характерной чертой сообществ нивальных миксомицетов Хибин является появление супердоминанта Physarum albescens. Встречаемость этого вида достигает рекордной величины среди всех изученных сообществ нивальных миксомицетов: 32 % от 716 образцов в Хибинах и 16 % от всех 1455 образцов из нашей коллекции.

Сообщество пояса березового криволесья характеризуется такими видами как:

Physarum albescens (164 из 231 найденного образца этого вида данной коллекции), Diderma alpinum (106 из 143), D. niveum (44 из 79), Lamproderma pulveratum (36 из 37), Diderma globosum var. europaeum (19 из 20), Trichia alpina (18 из 19), Diderma meyerae (17 из 37), D.

microcarpum (14 из 21), Lepidoderma chailletii (14 из 16), Meriderma spinulosporum (13 из 17).

Остальные виды, отмеченные только в этом растительном поясе, являются редкими и были отмечены один или два раза, за исключением Meriderma echinulatum (8 образцов).

В арктической тундре наиболее часто встречаются Physarum albescens (67 из 231), Diderma alpinum (37 из 143), D. niveum (35 из 79), Lamproderma sauteri (18 из 34), Diderma meyerae (16 из 33), D. microcarpum (7 из 21).

Индекс отношения числа видов к числу родов (S/G) меняется от 2,5 в арктической тундре до 3,1 в березовом криволесье. Эти значения ниже аналогичных индексов, полученных для Северо-Западного Кавказа, где он варьирует от 3,7 до 4,5 [158].

Сообщество нивальных миксомицетов Северо-Западного Кавказа Видовое разнообразие К началу наших исследований нивальные миксомицеты Кавказа не изучались. Нами на территории Тебердинского государственного биосферного заповедника была собрана коллекция из 561 образца спорокарпов, относящихся к 39 видам, 4 разновидностям и 3 формам нивальных миксомицетов из 8 родов и 5 семейств. Таким образом, все отмеченные таксоны были впервые найдены на Кавказе, 27 из них являются новыми для России.

Десять таксонов классифицированы как редкие (встречаемость 0,5 %). К группе часто встречающихся (3 %) видов были отнесены десять видов: Diderma meyerae (60 образцов), D. alpinum (50), Physarum alpestre (40), Ph. vernum (39), Lamproderma ovoideum (32), Meriderma carestiae (27), Lamproderma pulveratum (25), Diderma globosum var. europaeum (24), Meriderma echinulatum (18), Diderma niveum (16), что вместе составляет 59 % от всего числа зарегистрированных образцов. При этом только Diderma meyerae, D. alpinum, Lamproderma ovoideum и Physarum vernum были отмечены на более чем 50 % обследованных пробных площадей (на 16-и, 13-и, 12-и и 11-и из всех 23 соответственно). Таким образом, сообщество нивальных миксомицетов Северо-Западного Кавказа является более выровненным и, ввиду достаточно высокого видового разнообразия (H’=3,36, E=0,87, D=0,05), более богатым по сравнению с сообществом Хибин.

График накопления видов и значений максимального среднего индекса Chao1 на Рис.

27 показывает, что нами была выявлена большая часть ожидаемых на Северо-Западном Кавказе видов: Chao1=46±2,59 и 46 таксонов, а также в субальпийских (Chao1=37,33±2,55 и 35 соотв.) и альпийских травянистых сообществах (Chao1=44,11±3,1 и 41 соотв.), тогда как выявленность видового состава в березово-рододендровом криволесье недостаточна (Chao1=66±30,45 и 27 соотв.).

Видовое богатство и разнообразие возрастают от пояса криволесья (27 таксонов, H’=2,92, E=0,88, D=0,005, 95 образцов спорокарпов) к поясу субальпийских травянистокустарниковых сообществ (35 таксонов, H’=3,11, E=0,83, D=0,010, 171 образец) и Рис. 27. Оценка выявления полного числа видов на Северо-Западном Кавказе в зависимости от количества образцов. Обозначения линий как на Рис. 24. БСК – березовое субальпийское криволесье, АЛПа – субальпийский растительный пояс, АЛПб – альпийский пояс.

достигает максимальных значений в альпийских луговых сообществах (41 таксон, H’=3,2, E=0,84, D=0,007, 295 образцов).

Среди самых часто встречающихся видов в березовых криволесьях (БСК) были отмечены: Diderma globosum var. europaeum (12), D. meyerae (12) и D. alpinum (8), Meriderma echinulatum (7), Lamproderma echinosporum (6), L. maculatum (6), Physarum vernum (6), Lamproderma ovoideum (5), M. carestiae (5), Lamproderma pulveratum (4).

Наиболее распространенными видами в субальпийском травянисто-кустарниковом сообществе (АЛПа) оказались те же виды, что и в предыдущем типе растительности, но их соотношение оказалось иным: Diderma alpinum (26 образцов), Meriderma carestiae (20), Diderma meyerae (11), Physarum vernum (11), Diderma globosum var. europaeum (8), Lamproderma pulveratum (7) и Meriderma echinulatum (4).

Пояс альпийских луговых сообществ (АЛПб) несколько отличается своими видамидоминантами: Physarum alpestre (38), Diderma meyerae (37), Lamproderma ovoideum (25), Physarum vernum (22), Diderma alpinum (16), D. niveum (10), Lepidoderma carestianum (10), и Physarum nivale (10). Напротив, виды Lamproderma maculatum (1 образец), L. echinosporum (2) и Meriderma carestiae (2) становятся очень редкими (Рис. 28).

Индекс отношения числа видов к числу родов (S/G) в БСК был достаточно низким: 3,7;

для АЛПа и АЛПб эти значения равны 4,5 и 4,0 соответственно [158].

Рис. 28. График рангового распределения видов нивальных миксомицетов Северо-Западного Кавказа в разных типах растительности. БСК – субальпийское березое криволесье, АЛПа – субальпийский растительный пояс, АЛПб – альпийский пояс.

Генетическое разнообразие Интересно, что анализ частичных последовательностей гена 18S рРНК, полученных из образцов морфовидов, т.е. видов и таксонов внутривидового уровня, определенных на основании морфологических признаков, темноспоровых миксомицетов, показал значительное генетическое разнообразие в пределах отдельных морфотипов [158].

Нам удалось выявить 58 генотипов, полученных из 144 последовательностей, которые соответствуют 35 морфотипам темноспоровых видов из порядков Stemonitales и Physarales.

Следует подчеркнуть, что все проанализированные последовательности несли характерный для темноспоровых миксомицетов мотив “TCTCTCT”, начиная с 53 позиции (счет от первого нуклеотида после окончания последовательности праймера) Многие [60].

последовательности одних и тех же морфовидов имели отличия в нескольких позициях, что вряд ли может быть объяснено единичными мутациями. Наиболее вариабельными были участки, кодирующие петли E8_1, E10 и E10_1 в соответствии с номенклатурой вторичной структуры рРНК [236]. Большинство проанализированных морфовидов были представлены более чем одним генотипом, в среднем 1,7 генотип на один морфовид.

Кривые накопления, построенные для морфотипов, были более пологими по сравнению с кривыми для генотипов. Соответственно индексы Chao1 для кривой накопления генотипов были почти в 2,5 раза выше, чем таковые морфотипов: 117,1±21,9 и 46,9±8,4 соотв. (Рис. 29).

Однако число генотипов, приходящихся на один морфовид, растет нелинейно по мере увеличения числа полученных последовательностей. Так, для таксонов, для которых было получено по две последовательности, нами было выявлено в среднем 1,6 генотипов, по три – 2, по пять – 3, более чем 10 – 4,7. В большинстве случаев, морфовиды хорошо соотносятся со своими уникальными генотипами, которые часто идентичны генотипам образцов тех же морфовидов из других регионов, например Европейских Альп. Заметным исключением стали трудные в таксономическом плане виды р. Diderma (D. alpinum, D. globosum var.

europaeum, D. microcarpum, D. meyerae, D. niveum), Lamproderma sauteri и особенно виды р.

Meriderma. В последнем случае только M. aggregatum и M. fuscatum (референсные последовательности для этих видов были получены из GenBank) хорошо соотносились со своими генотипами.

–  –  –

Обобщенный анализ с учетом последовательностей образцов из GenBank, показал, что 194 последовательности из 60 таксонов пор. Stemonitales соответствуют 103 генотипам. При этом среднее генетическое расстояние, т.е. мера генетического различия, между видами составило 0,168, а в пределах одного вида 0,021. В пор. Physarales 103 последовательности, отнесенные к 40 морфовидам, дали 74 генотипа, со средним генетическим расстоянием между видами 0,097, внутри вида 0,003.

Очевидно, что необходимы дальнейшие исследования для установления корреляции между полученным генетическим и выявленным морфологическим разнообразием. Это важно для разрешения вопроса о внутривидовой структуре сложных комплексов морфовидов.

Сообщество нивальных миксомицетов таежных ландшафтов Ленинградской области и Карелии Как было отмечено ранее, в литературе имеются описания видового разнообразия и богатства сообществ нивальных миксомицетов горных ландшафтов, тогда как нивальные миксомицеты равнинных лесов практически не исследовались. До начала нашей работы в равнинных таежных ландшафтах было найдено только 3 вида нивальных миксомицетов Diderma niveum, Lamproderma arcyrioides, Lepidoderma carestianum [15].

В результате исследований, проведенных нами на территории Ленинградской области и Карелии, была собрана коллекция из 178 образцов спорокарпов, относящихся к 14 видам, 1 разновидности и 1 форме нивальных миксомицетов из 5 родов и 3 семейств. Среди них два таксона новые для России: Meriderma aggregatum f. macrosporum и Lamproderma zonatum.

Большая часть видов (11) была отнесена к массовым, на долю которых приходится 94 % всех найденных образцов.

Как видно из графика накопления видов на Рис. 30 и значений максимального среднего индекса Chao1, нами была выявлена большая часть ожидаемых видов в исследованных районах: Chao1=18,0±3,7 против 16 выявленных. Сходные значения были получены для ельника-черничника: Chao1=17,0±1,44 и 16 соответственно, тогда как сосняк-черничник был изучен явно недостаточно: Chao1=15,0±11,7 и 8 зарегистрированных видов. Эти же данные подтверждаются расчетом индекса Тьюринга, который указывает, что видовой состав в регионе в целом выявлен на 99 %.

Рис. 30. Зависимость видового богатства в таежных лесах Ленинградской области и Карелии от числа найденных образцов. Обозначение линий как на Рис. 24. ЕЧ – ельник-черничник, СЧ – сосняк-черничник.

Видовое богатство и разнообразие резко уменьшаются при переходе от ельникачерничника (14 видов, 1 разновидность, 1 форма, 163 образца; H=2,42, E=0,87, D=0,1) к сосняку-черничнику (8 видов, 15 образцов; H=1,7, E=0,88, D=0,19). Сосняк, по-видимому, ввиду разреженности древостоя не является благоприятным биотопом для нивальных видов, хотя нельзя исключить факт недостаточности обследования этого типа растительности.

Рис. 31. График рангового распределения видов нивальных миксомицетов Ленинградской области и Карелии в разных типах таежной растительности. ЕЧ – ельник-черничник, СЧ – сосняк-черничник.

–  –  –

Наиболее значимыми по числу видов в сообществе нивальных миксомицетов на всей изученной территории являются 2 семейства из 5: Stemonitidaceae (31 таксон; 54,7 % от общего числа видов) и Didymiaceae (16; 30,9 %). Они включают 85,6 % всех выявленных видов. К остальным 3 семействам относятся Physaraceae (5; 9,0 %), Trichiaceae (2; 3,6 %), и Dianemataceae (1; 1,8 %). Эти же пропорции сохраняются в горных ландшафтах, тогда как на равнинах на уровне семейств таксономические спектры значительно упрощаются (Рис. 33), эта тенденция еще более усиливается на уровне родов (Рис. 34).

Рис. 32. Спектры порядков нивальных миксомицетов (в процентах от общего числа видов) в горных и равнинных районах исследования.

В таежных равнинах полностью исчезают представители семейств Trichiaceae и Dianemataceae (Рис. 33), а также не встречаются таксоны таких родов как Didymium, Diacheopsis, Trichia и Dianema (Рис. 34).

Рис. 33. Спектры семейств нивальных миксомицетов (в процентах от общего числа видов) в горных и равнинных районах исследования.

С другой стороны следует подчеркнуть, что доля родов Lamproderma (5 видов; 31 %) и Meriderma (6; 36,5 %) значительно увеличивается в сообществах нивальных миксомицетов равнинных ландшафтов (Рис. 34).

Рис. 34. Спектры родов нивальных миксомицетов (в процентах от общего числа видов) в горных и равнинных районах исследования.

–  –  –

На уровне порядков наиболее сильно отличаются структуры сообществ арктической тундры (Рис. 35), где преобладают виды порядка Physarales (63 %) и сообщества тайги равнинных ландшафтов, где преобладают виды порядка Stemonitales (69 %).

Рис. 35. Спектры порядков нивальных миксомицетов (в процентах от общего числа видов) в изученных типах растительности, обозначения которых даны в подписи к Табл.4.

Наиболее значимыми по числу видов в сообществе нивальных миксомицетов субальпийских криволесий являются 2 семейства: Stemonitidaceae (15 таксонов; 60 % от общего числа видов) и Didymiaceae (11; 27,5 %). Еще 2 семейства Physaraceae (4; 10 %) и Trichiaceae (1; 2,5 %) вносят небольшой вклад. В безлесных альпийских сообществах сохраняется похожая таксономическая структура, но несколько возрастает роль сем.

Didymiaceae (16; 34 %), а роль сем. Stemonitidaceae снижается (23; 49 %). В таежных сообществах разрыв между этими семействами увеличивается еще больше (Рис. 36).

Рис. 36. Спектры семейств нивальных миксомицетов (в процентах от общего числа видов) в изученных типах растительности, обозначения которых даны в подписи к Табл.4.

Изменение таксономической структуры сообществ нивальных миксомицетов в различных типах растительности наиболее контрастно проявляется на уровне родов (Рис.



Pages:   || 2 |
Похожие работы:

«Ипотечный калькулятор Ипотечным калькулятором можно воспользоваться в левой колонке нашего сайта.   Если вы задумываетесь о покупке квартиры, но понимаете, что без ипотеки вам не обойтись, сначала неплохо бы прицениться и узнать, на какую сумму займа и под какой процент стоит рассчи...»

«1 www.bergenschild.narod.ru Д.А. Лобанов Полковник Ушаков Борис Федорович Борис Федорович Ушаков родился в 2 мая 1889 года. Учился в Псковском кадетском военном корпусе, который закончил в 1906 год...»

«Инна Соломоновна Соловьева С мамой о прекрасном. Русская живопись от Карла Брюллова до Ивана Айвазовского Серия "С мамой о прекрасном. Просто и увлекательно о живописи" Издательский текст http://www.l...»

«ПРОГРАММА ВОСПИТАТЕЛЬНОЙ РАБОТЫ С ИСПОЛЬЗОВАНИЕМ ДОЛГОСРОЧНЫХ ПРОЕКТОВ "УМКА СОБИРАЕТ ДРУЗЕЙ" САНКТ-ПЕТЕРБУРГ Содержание 1. Обоснование необходимости внедрения программы воспитательной работы с использованием долгосрочных проектов.1.1. Необходимость и целесообразность.2. Практическое значение внедрения программ...»

«АНАЛИЗ И ОЦЕНКА РАЗВИТИЯ РЫНКА НЕДВИЖИМОСТИ В АКТЮБИНСКОМ РЕГИОНЕ НА СОВРЕМЕННОМ ЭТАПЕ Кулумбетова Д.Б. Давлеткалиева К.Б. Казахско-Русский международный университет, г. Актобе Аннотация. В статье дается характеристика рынка жилой недвижимости, рассматриваются факторы, оказывающие влияние на его формирование...»

«1306325 Т-ХЕЛПЕР ГРУППА КОМПАНИИ ШИЛ Ш РАДИОРЕЛЕЙНЫЕ И ОПТОВОЛОКОННЫЕ СИСТЕМЫ 2011-2012 Nokia Siemens л Networks UF1 ;AVARA Оглавление 1 О компании Применение систем связи 2 ТЭК, службы спасения, силовые стру...»

«Yaware.TimeTracker инструмент учёта рабочего времени и мониторинга эффективности работы сотрудников за компьютером.• мониторинг программ и сайтов, посещаемых сотрудниками • учёт опозданий и уходов пораньше • фактически отработанное время • скриншоты экрана и снимки вебкам...»

«КОМЕДИАДА 2011 Приветствие президента фестиваля "Комедиада" народного артиста Украины Георгия Делиева Здравствуйте, дорогие Клоуны, любители будет бурно расти и набирать обороты, и в и знатоки...»

«Очерк 4 Готовность и предварительное переживание В нашей повседневной жизни мы часто сталкиваемся с феноменом готовности. Уже поверхностное размышление дает смутно почувствовать универсальный характер этого феномена. В настоящем очерке 1 я постараюсь осуществить его философский анализ. В моей ра...»

«Переходи на НОЛЬ 2016_9 Тарифный план действует для абонентов, заключивших договор об оказании услуг связи на территории Чувашской Республики Тарифный план действует на территории Чувашской Республики Авансовая система расчетов Стоимость перехода на тарифный план: в случае смены тарифного плана первый раз в месяц: 0 руб. 49,00р. в случае...»

«РОССИЯ. XX ВЕК Д О К У М Е Н Т Ы СЕРИЯ ОСНОВАНА В 1997 ГОДУ ПОД ОБЩЕЙ РЕДАКЦИЕЙ АКАДЕМИКА А.Н. ЯКОВЛЕВА РЕДАКЦИОННЫЙ СОВЕТ: А.Н. Яковлев (председатель), Е.Т. Гайдар, В.П. Козлов, В.А. Мартынов, С В. Мироненко, В.П. Наумов, Е.М. Примаков, А.Н. Сахаров, Г.Н. Севостьянов, Н.Г....»

«Анализ анкетирования пользователей авиаметеорологической информации на предмет качества обслуживания В соответствии с п. 2.5 "Плана основных мероприятий Федеральной службы по гидрометеорологии и мониторингу окружающей среды на 2012 год" ФГБУ "Авиаметтелеком Р...»

«УДК 111.8 А.Р.Бурханов A.R.Burhanov Екатеринбург, Россия Ekaterinburg, Russia АНТРОПОЛОГИЧЕСКИЕ ANTHROPOLOGICAL СМЫСЛЫ DASEIN В ТРАКТАТЕ ANALYSIS OF DASEIN IN МАРТИНА ХАЙДЕГГЕРА MARTIN HEIDEGGER’S "БЫТИЕ И ВРЕМЯ" MAGNUM OPUS “BEING AND TIME” Аннотация. В статье исследуются основоположения...»

«СОДЕРЖАНИЕ ВВЕДЕНИЕ 1. ТЕОРЕТИЧЕСКИЕ ОСНОВЫ ОРГАНИЗАЦИИ ОПЛАТЫ ТРУДА КАК ЭЛЕМЕНТА СТИМУЛИРОВАНИЯ ТРУДА В ОРГАНИЗАЦИИ. 5 1.1. Значение заработной платы как основного элемента стимулирования труда 1.2. Понятие и факторы оплаты труда на предприятии 1.3. Формы и системы оплаты труда 2. АНАЛИЗ ЭФФЕКТИВНОСТИ СИСТЕМЫ ОПЛАТЫ ТРУДА И...»

«Глава 4 Документирование хозяйственных операций В данной главе рассмотрен порядок ведения бухгалтерского учета на стадиях: – документального оформления хозяйственных операций;– текущей группировки фактов хозяйственной деятельности. Оформление хозяйственных операций первичными документами Все хозяйственные оп...»

«УДК 159.96 ББК 88.6 Д94 Перевод с английского Л. Милевской Дэйл Синди Д94 Кундалини: Божественная энергия. Теория и практика / Перев. с англ. — М.: ООО Издательство "София", 2012. — 256 с. ISBN 978-5-399-00383-...»

«40 С. В. Алейник, М. Б. Столбов УДК 621.391.037.372 С. В. АЛЕЙНИК, М. Б. СТОЛБОВ СТОХАСТИЧНОСТЬ РЕЧЕВЫХ СИГНАЛОВ И ЕЕ ОЦЕНИВАНИЕ Проанализированы способы оценки стохастичности речевых сигналов. Результаты моделирования показали, что предложенный способ оценки превосходит известные по качеству — оценки имеют меньшее смещени...»

«ДЛЯ ЦЕРКОВНОГО СУДА Его Святейшеству Святейшему Патриарху Московскому и всея Руси КИРИЛЛУ регента Храма Спаса Нерукотворного Образа в Андрониковом монастыре, студента экстерната МПДС Валерия Сутормин...»

«ГОДОВОЙ ОТЧЕТ Общество с ограниченной ответственностью "Сэтл Групп" за: 2007 год Место нахождения Общества: Россия, 196066, Санкт-Петербург, Московский пр., дом 212, литер А. Настоящим подтверждается достоверность информации и данных об Обществе с ограниченной ответственностью "Сэтл Групп", содержащихс...»

«Автоматическая локомотивная сигнализация (АЛС) представляет. http://oltep.km.ru/hepl_torm/9.1/9.1.htm Автоматическая локомотивная сигнализация (АЛС) представляет собой комплекс устройств, автоматически повторяющих в кабине машиниста показания путевых...»

«XJ0300106 СООБЩЕНИЯ ОБЪЕДИНЕННОГО ИНСТИТУТА ЯДЕРНЫХ ИССЛЕДОВАНИЙ Дубна Р6-2002-159 В. Г. Калинников, Ж. К. Саматов, А. А. Солнышкин, Ж. Сэрээтэр, Н. А. Лебедев, В. Г. Чумин, Я. С. Ибрахим КАЛИБРОВКА р-СПЕКТРОМЕТРА ТИПА "МИНИ-АПЕЛЬСИН" ПО ЭФФЕКТИВНОСТИ С ПОМОЩЬЮ рСПЕКТР A ^Sr © Объединенный институт...»

«Социологические исследования № 11, 2015 Habermas J. Theorie des kommunikativen Handelns. Band 1, 2. Frankfurt am Main: Suhrkamp, 1981. Keller J. Djiny klasick sociologie. Praha: Sociologick nakladatelstv (SLON), 2004. Latour B. Reassembling the Social. An Introduction to Actor-Network-Theory. New York: Oxford University Press, 200...»

«E. И. ДЕРГАЧЕВА-СКОП "Похвала" Сибири С. У. Ремезова' Среди карт и деловых статей "Служебной чертежной книги" С. У. Ремезова,2 являющейся своеобразной "записной книжкой" сибир­ ского картографа, имется ряд сочинений литературного характера: "По­ беда на Кучума-царя. Очищение всей Сибири", "...»









 
2017 www.lib.knigi-x.ru - «Бесплатная электронная библиотека - электронные матриалы»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.