WWW.LIB.KNIGI-X.RU
БЕСПЛАТНАЯ  ИНТЕРНЕТ  БИБЛИОТЕКА - Электронные матриалы
 


Pages:   || 2 |

«ГИДРОЛИЗ РАЦЕМИЧЕСКИХ АМИДОВ ФЕРМЕНТАМИ ПОЧВЕННЫХ АКТИНОБАКТЕРИЙ ...»

-- [ Страница 1 ] --

РОССИЙСКАЯ АКАДЕМИЯ НАУК

ФЕДЕРАЛЬНОЕ ГОСУДАРСТВЕННОЕ БЮДЖЕТНОЕ УЧРЕЖДЕНИЕ НАУКИ

ИНСТИТУТ ЭКОЛОГИИ И ГЕНЕТИКИ МИКРООРГАНИЗМОВ

УРАЛЬСКОГО ОТДЕЛЕНИЯ РОССИЙСКОЙ АКАДЕМИИ НАУК

На правах рукописи

ГОРБУНОВА Анна Николаевна

ГИДРОЛИЗ РАЦЕМИЧЕСКИХ АМИДОВ

ФЕРМЕНТАМИ ПОЧВЕННЫХ АКТИНОБАКТЕРИЙ

03.02.03 Микробиология Диссертация на соискание ученой степени кандидата биологических наук

Научный руководитель:

кандидат биологических наук, доцент Максимов А. Ю.

Пермь – 2014

ОГЛАВЛЕНИЕ

ВВЕДЕНИЕ

ГЛАВА 1. ОБЗОР ЛИТЕРАТУРЫ

1.1. Амидазы – нитрилгидролизующие ферменты

1.1.1. Применение L- и D-энантиомеров аминокислот

1.1.2. L-селективные аминокислотные амидазы

1.1.3. D-селективные аминокислотные амидазы

1.2. Биотрансформация субстратов иммобилизованными амидазами......... 29 1.2.1. Иммобилизация клеток с амидазной активностью

1.2.2. Иммобилизация выделенных амидаз

1.3. Факторы, влияющие на стереоселективность ферментов

1.4. Энантиоселективная биотрансформация D,L-фенилглицинонитрила. 36

1.5. Биотрансформация фенилаланинамида

ГЛАВА 2. ОБЪЕКТЫ И МЕТОДЫ ИССЛЕДОВАНИЯ

2.1. Объекты исследования

2.2. Выделение и идентификация амидгидролизующих бактерий............... 43

2.3. Среды и субстраты для культивирования

2.4. Определение амидазной активности и стереоселективности штаммов 46

2.5. Выделение амидазы

2.6. Иммобилизация

2.7. Определение продуктов реакции трансформации нитрилов и амидов 50

2.8. Выделение ДНК и полимеразная цепная реакция

2.9. Секвенирование ДНК

2. 10. Статистическая обработка

ГЛАВА 3. ИССЛЕДОВАНИЕ КУЛЬТУРАЛЬНЫХ И

СТЕРЕОСЕЛЕКТИВНЫХ СВОЙСТВ ШТАММОВ R. rhodochrous 4-1 и Arthrobacter sp. 6-1

3.1. Выделение и селекция штаммов, способных к стереоселективной трансформации D,L-лактамида

3.2. ПЦР-анализ генов D-аминокислотных амидаз

3.3. Идентификация выделенных культур

3.4. Влияние источника углерода на рост и амидазную активность бактерий

3.5. Влияние источника азота на рост и амидазную активность бактерий.. 65

3.6. Влияние иммобилизации на стереоселективные свойства внутриклеточных амидаз

ГЛАВА 4. СТЕРЕОСЕЛЕКТИВНЫЕ СВОЙСТВА ФЕРМЕНТНЫХ

ПРЕПАРАТОВ АМИДАЗ R. rhodochrous 4-1 и Arthrobacter sp. 6-1............... 69

4.1. Каталитические свойства амидазы, иммобилизованной методом ковалентной сшивки с хитозаном, активированным бензохиноном........... 69

4.2. Стереоселективные свойства амидаз, иммобилизованных различными методами

4.3. Влияние температуры на стереоселективные свойства ферментных препаратов амидаз

4.4. Влияние рН на стереоселективные свойства ферментных препаратов амидаз

ГЛАВА 5. БИОТРАНСФОРМАЦИЯ АРОМАТИЧЕСКИХ АМИДОВ

АМИНОКИСЛОТ

5.1. Биотрансформация D,L-фенилглицинонитрила

5.1.1. Скрининг микроорганизмов, способных к гидролизу D,Lфенилглицинонитрила

5.1.2. Индукция нитрилгидролизующей активности штамма Rhodococcus rhodochrous 4-1

5.1.3. Трансформация D,L-фенилглицинонитрила изолированной амидазой R. rhodochrous 4-1

5.1.4. Влияние температуры на активность и стереоселективность амидазы R. rhodochrous 4-1 в реакции гидролиза D,Lфенилглицинонитрила

5.1.5. Влияние иммобилизации нитрилгидратазы и амидазы R. rhodochrous 4-1 на стереоселективность реакции

5.2. Биотрансформация L-фенилаланинамида

ЗАКЛЮЧЕНИЕ

ВЫВОДЫ

СПИСОК ЛИТЕРАТУРЫ

ВВЕДЕНИЕ

Актуальность проблемы В последние годы получение оптически чистых аминокислот становится все более и более актуальной задачей современной биотехнологии (Leuchtenberger et al., 2005). Являясь не только структурными элементами белков и других эндогенных соединений, аминокислоты имеют большое функциональное значение. Их применяют в пищевой промышленности, в животноводстве и ветеринарии для питания и лечения животных (Сафонова, 1974; Bercovici, Fuller, 1995). Некоторые аминокислоты нашли применение в здравоохранении, в изготовлении косметических средств, в качестве питательных сред для производства вакцин (James, 2003). Намечаются пути использования аминокислот в химической промышленности (Schoemaker et al., 1992). Непротеиногенные аминокислоты выступают в качестве предшественников новых инсектицидов, гербицидов и полусинтетических антибиотиков (Breuer et al., 2004; Kamphuis et al., 1990).

В настоящее время основой крупнотоннажного производства аминокислот служит микробиологический синтез - около 60% от производимого объема (Leuchtenberger et al., 2005). В меньшей степени распространен химический синтез, а также получение аминокислот путем гидролиза белков.

Микробиологический способ получения аминокислот основан на способности микроорганизмов синтезировать все L-аминокислоты, а в определенных условиях, — обеспечивать их «сверхсинтез». Однако, живые организмы, с которыми приходится работать, очень чувствительны к малейшему изменению условий, концентрация целевого продукта получается низкой, что требует увеличения размеров реакторов. При микробиологическом синтезе образуются только L-аминокислоты, метод не позволяет получать непротеиногенные аминокислоты и их производные (Якубке, Ешкайт, 1985).

В результате химического синтеза образуется рацемическая смесь аминокислот, требующая разделения, а в большинстве других случаев доля одного из изомеров ненамного превышает содержание второго (Nakamura et al., 1980).

Одним из перспективных путей получения оптически чистых аминокислот является использование отдельных ферментов. В настоящее время интенсивно изучаются процессы ферментативного разделения рацемической смеси амидов аминокислот с помощью стереоселективных амидаз. Эти ферменты обладают широкой субстратной специфичностью, катализируют реакции без образования побочных продуктов, а сам процесс трансформации проводится в водных растворах при температуре 25-35°С.

Кроме того, наличие амидаз, стереоспецифичных как к L-, так и к Dизомерам, позволяет осуществлять выбор схемы процесса разделения рацематов аминокислот в зависимости от того, какой из двух оптических изомеров необходимо получить.

В связи с этим, поиск новых биокатализаторов стереоселективного гидролиза рацемических амидов, а также изучение их каталитических свойств и влияния внешних факторов на стереоизомерию образующихся продуктов является актуальной задачей биотехнологии.

Стереоселективность является определяющим свойством в гидролизе рацемических аминокислотных амидов. Известно, что большинство выделенных и охарактеризованных на данный момент амидаз проявляют Sселективность (Sharma et al., 2009). Однако стереоспецифичность ферментов не является строгой и зависит от ряда различных факторов таких, как рН реакционной среды, температура, метод иммобилизации фермента, структура субстрата. Несмотря на то, что амидазы выступают эффективными биокатализаторами стереоселективного гидролиза, в научной литературе практически не встречаются данные, касающиеся влияния различных факторов на их стереоселективные свойства.

Цель настоящего исследования – поиск новых штаммов бактерий, способных к стереоселективной биотрансформации амидов и изучение катализируемых ими процессов в гомогенных и гетерогенных системах.

Основные задачи исследования:

1. Выделить и селекционировать микроорганизмы, способные к стереоселективному гидролизу рацемических амидов.

2. Исследовать влияние различных факторов среды на рост и амидазную активность штаммов.

3. Изучить влияние ряда факторов реакционной среды (температуры, рН) и различных способов иммобилизации на стереоселективные и каталитические свойства амидаз.

4. Определить способность изолятов к стереоселективному гидролизу D,L-фенилглицинонитрила.

5. Исследовать способность активных изолятов к биотрансформации фенилаланинамида.

Состояние вопроса Первые попытки использования живых организмов для разделения рацематов аминокислот основывались на способности животных усваивать лишь один антипод. При скармливании или введении животному рацемической смеси аминокислоты из его мочи удавалось выделить не усвоившийся D-энантиомер аминокислоты (Wolgemuth, 1905; Kyokawa, 1933). Несмотря на очевидные недостатки: безвозвратную потерю половины исходного вещества, трудности выделения из смеси, содержащей целый ряд всевозможных органических соединений, получение в результате физиологически обычно менее активного, а, следовательно, и менее ценного D-энантиомера аминокислоты, - этот метод не потерял до сих пор своего значения. В 1976 году в Японии начали получать D-аминокислоты и их эфиры после действия на рацемическую смесь аминокислот клеток микроорганизмов: Mycoplasma, Protaminobacter, Acetobacter, Pseudomonas, Aeromonas, Xanthomonas и Bacillus. В результате этой процедуры L-изомер ассимилировался бактериями, а D-изомер выделялся из культуральной среды после отделения клеток центрифугированием.

Большой успех был достигнут при использовании отдельных ферментных препаратов различной степени очистки. В этом случае протекает только одна химическая реакция, и удается выделить оба энантиомера аминокислоты. Все ферментативные методы разделения рацематов аминокислот можно разделить на следующие группы, указанные в порядке возрастания их практической ценности и степени использования (Швядас,

Галаев, 1983):

1) специфические методы разделения рацематов, пригодные лишь для отдельных аминокислот (лизин, цистеин, ароматические аминокислоты);

2) стереоселективное окисление и декарбоксилирование аминокислот;

3) энантиоселективный синтез амидной связи;

4) стереоселективный гидролиз амидов и сложных эфиров аминокислот;

5) энантиоселективный гидролиз N-ацилированных аминокислот.

Первое промышленное применение ферментов для получения энантиомеров аминокислот относятся к 50-м годам. C 1954 года компания Tanabe Seiyaku Co., Osaka (Япония) начала применять метод энзиматической резолюции для промышленного получения L-аминокислот с помощью аминоацилаз (N-ациламинокислотных амидогидролаз) (Chibata et al., 1976). В 1969 году иммобилизованная аминоацилаза стала первым в мире примером успешного промышленного применения иммобилизованных ферментов (Chibata, 1978).

В 1973 году японская фирма «Toray Industry» предложила комбинированный или хемо-энзиматический способ получения L-лизина (Fukumura et al., 1978). Технология процесса включает в себя органический синтез D,L--амино--капролактама (циклического ангидрида лизина) из циклогексана и его ферментативный гидролиз с участием гидролазы аминокапролактама (рисунок 1). Данная технология ведет к образованию Lлизина с 95%-ным выходом и 99%-ной оптической чистотой. Гидролазу аминокапролактама синтезируют дрожжи Candida, Trichospora, Cryptococcus (Sano, 1978; Fukumura, 1974), фермент стимулируется катионами цинка, магния, марганца. Источником рацемазы аминокапролактама могут служить бактерии Flavobacterium, Achromobacter (Fukumura, 1977).

Рисунок 1 – Комбинированный или хемо-энзиматический способ получения L-лизина (Fukumura, 1974).

Стереоселективный гидролиз амидов аминокислот для разделения рацематов на оптические антиподы впервые был применен в 1978 году. Был запатентован способ получения L- и D--аминокислот путем биотрансформации рацемических -аминоамидов с помощью L-аминоациламидаз (Boesten et al., 1978).

Причем -аминоамиды и их предшественники -аминонитрилы предполагалось получать химическим синтезом из смеси альдегид-цианид-аммоний (синтез Штрекера):

R-CHO + CN- + NH3 = R-CH-(CH2)-CN + H2O = R-CH-(CH2)-CO-NH2.

Было показано, что некоторые базидиомицеты (Strobel, 1966, 1967) и бактерии рода Corynebacterium (Fukuda et al., 1973), способны гидролизовать D,L--аминоамиды в смесь D--аминоамида и L--аминокислоты. Была предложена общая схема для синтеза оптически активных -аминокислот (рис. 2).

–  –  –

Maestracci с соавт. предложили использовать стереоселективные амидазы аминокислот вместе с рацемазой, которая превращает D-аминоамид в исходный рацемат (Maestracci et al., 1988).

Был предложен метод разделения D-аминокислотного амида и Lаминокислоты. В реакционную смесь добавляют один эквивалент бензальдегида, в результате формируется Шиффово основание с Dаминоамидом, который нерастворим в воде, и поэтому может быть легко отделен. Далее возможны два пути - ферментативный гидролиз Dбензальдегид аминоамида до D-аминокислоты или рацемизация Dбензальдегид аминоамида до D,L-амида аминокислоты (рисунок 3, А). Также была разработана методика для рацемизации и восстановления Lаминокислоты (рисунок 3, Б). В присутствии концентрированной кислоты с последующим добавлением аммония происходит конверсия L-аминокислоты в эфир. Добавление бензальдегида и рацемизация в щелочных условиях (рН=13) дает D,L-аминокислотный амид (Kamphuis et al., 1990).

Рисунок 3 – Схема получения L- и D--аминокислот: А – гидролиз и рацемизация D-аминокислотного амида, Б – рацемизация L-аминокислоты в рацемат (Kamphuis et al., 1990).

Стереоспецифический гидролиз амидов аминокислот с использованием амидаз – новый и совсем недавно коммерциализированный процесс ферментативного разделения рацематов. Поэтому сведения, касающиеся характеристики амидаз аминокислот, в настоящее время ограничены. В литературе имеется небольшое число работ, посвященных изучению амидаз, специфичных для L- или D-конфигурации аминокислот.

Амидаза, выделенная из клеток Mycobacterium neoaurum ATCC 25795, была впервые описана как фермент, проявляющий активность по отношению к L--алкил-замещенным амидам аминокислот (Hermes et al., 1994). Позднее была выделена и охарактеризована L-аминокислотная амидаза, выделенная из штамма Pseudomonas azotoformans IAM 1603. Фермент имел узкую субстратную специфичность, будучи активным только по отношению к Lпролинамиду, L-аланинамиду и L-метионинамиду (Komeda et al., 2004).

Штамм Ochrobactrum anthropi NCIMB 40321 проявлял высокую амидазную активность по отношению к,-дизамещенным -аминокислотным амидам,

-амидам гидроксикислот и -N-гидроксиаминокислотным амидам со строгой L-селективностью (Sonke et al., 2005). Komeda и Asano описали Lстереоселективную аминокислотную амидазу штамма Brevundimonas diminuta TPU 5720, которая проявляла стереоселективность по отношению к широкому ряду L-амидов аминокислот, включая L-фенилаланинамид, Lглутаминамид, L-лейцинамид, L-метионинамид, L-аргининамид и амид L-2аминомасляной кислоты (Komeda et al., 2006).

Среди D-стереоспецифических амидаз одной из первых была выделена амидаза штамма Ochrobactrum antropi SV3, которая катализировала энантиоселективный гидролиз ряда ароматических амидов аминокислот, включая D-фенилаланинамид, D-тирозинамид и D-триптофанамид (Komeda et al., 2000).

Термостабильная D-стереоспецифическая аланинамидаза, выделенная из термофила Brevibacillus borstelensis BCS-1, использовалась для гидролиза D-аланинамида (Sung et al., 2000; Baek et al., 2002). D-аланинамид специфическая амидогидролаза, выделенная из штамма Arthrobacter sp. NJтакже катализировала энантиоселективный гидролиз D,L-аланинамида с энантиомерным выходом 99% (Ozaki et al., 1992). Образующийся в результате гидролиза D-аланин используется в качестве сырья в синтезе подсластителей.

С помощью штамма 16 осуществлен Delftia acidovorans стереоселективный гидролиз D-tert-лейцинамида до D-tert-лейцина, одной из наиболее ценных D-аминокислот, коммерческая стоимость которой составляет более 100 долларов за грамм. Было установлено, что аминокислотная последовательность D-стереоселективной аминокислотной амидазы Delftia acidovorans на 67,9% гомологична D-аминокислотной амидазе бактерии Variovorax paradoxus (Hongpattarakere et al., 2005; Krieg et al., 2002).

Hayashi с соавт. описали R-энантиоселективную амидазу Comamonas acidovorans, которая гидролизует D-лейцинамид и D-фенилаланинамид, но имеет низкую стереоселективность (Hayashi et al., 1997).

На сегодняшний день нерешенными остаются несколько проблем стереоселективной трансформации аминокислотных амидов: выход процесса составляет 50%, возникают трудности при разделении L--аминокислоты от D--аминоамида, а также рацемизация последнего (Maestracci et al., 1988).

Эти недостатки могут быть устранены путем изучения свойств аминокислотных амидаз, получением мутантных штаммов, иммобилизацией клеток или выделенного фермента.

Таким образом, поиск и характеристика бактерий – продуцентов амидаз аминокислот остается актуальной задачей биотехнологии. Новые данные о природе и свойствах этих ферментов и их продуцентов позволят разработать новые, а также усовершенствовать существующие процессы биотрансформации.

Научная новизна Селекционированы культуры бактерий способные к стереоселективному гидролизу амидов аминокислот. Разработаны и синтезированы праймеры, комплементарные нуклеотидным последовательностям генов, кодирующих известные D-аминокислотные амидазы грамположительных и грамотрицательных микроорганизмов.

Впервые определено влияние различных факторов – состав культуральной среды, температура и рН реакционной среды – на стереоселективные свойства амидаз штаммов R. rhodochrous 4-1 и Arthrobacter sp. 6-1. Изучено влияние иммобилизации на каталитические и стереоселективные свойства биокатализаторов на основе целых бактериальных клеток и выделенных амидаз. Оптимизированы условия процесса биотрансформации D,Lфенилглицинонитрила и L-фенилаланинамида.

Теоретическое и практическое значение работы Полученные экпериментальные данные расширяют представления о процессах стереоселективной трансформации амидов клетками бактерий.

Определено влияние различных факторов внешней среды на стереоселективные свойства амидаз. Установлено, что для проявления стереоселективности амидазы в гетерогенном катализе определяющим фактором является присутствие носителя, который изменяет соотношение образующихся изомеров, что может быть использовано для увеличения энантиомерной чистоты продуктов ферментативной реакции.

Показана возможность получения изомеров фенилглицина и фенилаланина при трансформации соответствующих амидов стереоселективными амидазами. Оптимизирована среда культивирования наиболее перспективного изолята Arthrobacter sp., выделенного с целью дальнейшего использования в качестве биокатализатора гидролиза рацемических амидов.

Основные положения, выносимые на защиту:

1. Штаммы – продуценты амидаз R. rhodochrous 4-1 и Arthrobacter sp. 6-1 способны к стереоселективной трансформации D,L-лактамида с максимальным энантиомерным избытком 44 и 43% соответственно.

Иммобилизация клеток и оптимизация условий роста бактерий не дают увеличения энантиомерной чистоты продукта.

2. Иммобилизация амидазы методом ковалентной сшивки с активированным хитозаном приводила к повышению термо- и операционной стабильности; методом поперечно сшитых ферментных агрегатов - к повышению стереоселективности трансформации амидов.

3. Изученные штаммы трансформировали D,Lфенилглицинонитрил до L-фенилглицина с разной степенью стереоселективности, гидролизовали L-фенилаланинамид до Lфенилаланина.

Основные результаты Апробация работы и публикации диссертационной работы доложены и обсуждены на IV, V, VI, VII Всероссийском с международным участием конгрессе студентов и аспирантов-биологов «Симбиоз Россия» (Воронеж, 2011; Тверь, 2012;

Иркутск, 2013; Екатеринбург, 2014), Международной школе-конференции «Биология - наука 21 века» (Пущино, 2014).

Результаты проведенных исследований опубликованы в 10 научных работах: 4 статьи в журналах, рекомендованных ВАК Минобрнауки РФ, тезисы 6 докладов.

Объем и структура диссертации

Работа изложена на 126 страницах машинописного текста, содержит 35 рисунков и 17 таблиц, состоит из введения, обзора литературы, описания объектов и методов, трех глав результатов собственных исследований, заключения, выводов, списка литературы. Список литературы включает 189 наименований работ, в том числе 17 отечественных и 172 зарубежных автора.

Связь работы с научными программами и собственный вклад автора Диссертационная работа выполнена в соответствии с планом НИР Института экологии и генетики микроорганизмов УрО РАН и является частью исследований, проводимых по теме «Биохимические и генетические системы трансформации органических соединений у бактерий, перспективных для биотехнологий» (номер государственной регистрации 0120.0406511). Исследования выполнены при поддержке гранта РФФИ №13р_урал_а «Исследование стереоселективной биотрансформации амидов и сложных эфиров почвенными бактериями с применением энзимологических, метагеномных и геномных методов», 2013-2015 гг.

Личный вклад автора состоял в планировании и проведении экспериментов, критическом анализе полученных результатов. Автор участвовал в подготовке результатов работы к публикации и их представлении на научных конференциях.

Список принятых сокращений:

ВЭЖХ – высокоэффективная жидкостная хроматография;

ГХ – газовая хроматография;

ЕД – единица активности фермента, мкмоль/мг/мин;

МПА – мясопептонный агар;

ОП – оптическая плотность;

ПСФА – поперечно сшитые ферментные агрегаты;

ПЦР – полимеразная цепная реакция;

ФГ – фенилглицин;

ФГА – фенилглицинамид;

ФГН – фенилглицинонитрил;

ее – энантиомерный избыток;

LB – среда Луриа-Бертани;

LBА – агаризованная среда Луриа-Бертани.

ГЛАВА 1. ОБЗОР ЛИТЕРАТУРЫ

1.1. Амидазы – нитрилгидролизующие ферменты Амидазы – это ферменты, катализирующие гидролиз амидов до карбоновых кислот и аммония. Эти ферменты вовлечены в метаболизм азота и широко распространены в природе: обнаружены как в прокариотических, так и в эукариотических клетках (Fournand et al., 2001).

На основании аминокислотных последовательностей и структурных различий амидазы подразделяются на две группы: нитрилазное суперсемейство и семейство амидаз (amidase Ферменты signature).

нитрилазного суперсемейства существуют в растворе в виде гомотетрамерных и гомогексамерных комплексов и имеют консервативную каталитическую триаду глутамин-цистеин-лизин в активном центре.

Ферменты семейства амидаз формируют гомодимерные и гомооктамерные комплексы и отличаются наличием высококонсервативной последовательности из приблизительно 130 аминокислот, содержащей каталитическую триаду из лизина и двух остатков серина (Лавров, 2010;

Ohtaki et al., 2009). Субстратная специфичность сигнатурных амидаз шире, чем амидаз, нитрилазного суперсемейства, они способны гидролизовать наряду с алифатическими амидами также ароматические и разветвленные амиды – фенилацетамид, 2-фенилпропионамид, амид миндальной кислоты.

Часто эти амидазы обладают стереоселективностью (Chen et al., 2009).

Известно, что у прокариот амидазная активность часто сопряжена с метаболизмом нитрилов в нитрилгидратзно-амидазном пути гидролиза этих соединений. Однако алифатические амидазы встречаются и у бактерий, метаболизирующих нитрилы с участием нитрилаз, а также и у неспособных трансформировать эти соединения (Перцович, 2005).

1.1.1. Применение L- и D-энантиомеров аминокислот В последние годы ученые уделяют большое внимание исследованию свойств, путей получения и возможностей применения аминокислот. Эти вещества, из которых в природе строятся все растительные и животные белки, представляют огромный практический интерес. Традиционно аминокислоты применяют в качестве пищевых и кормовых добавок, в качестве медицинских и фармацевтических препаратов (Шпак, 1983).

В настоящее время энантиомерно чистые L- и D-аминокислоты все чаще выступают хиральными строительными блоками в производстве различных соединений. Так, L-аминокислоты являются предшественниками лекарственных препаратов, полусинтетических антибиотиков и физиологически активных пептидов (таблица 1).

D-аминокислоты используются в синтезе биологически активных молекул таких, как полусинтетические антибиотики, пептидные гормоны, пиретроидные инсектициды и подсластители (таблица 2).

Применение аминокислот постоянно расширяется и лимитируется только необходимой степенью очистки и высокой стоимостью производства.

Поэтому во всем мире ведутся исследования, направленные на создание и развитие методов производства этих соединений (Беликов, 1980).

Одним из перспективных путей получения оптически чистых аминокислот является использование отдельных ферментов. Так, амидазы, способные осуществлять стереоселективный гидролиз аминокислотных амидов, ведут к получению как L-, так и D-энантиомеров аминокислот (Schoemaker et al., 1992).

Таблица 1 – Примеры промышленного применения L-аминокислот Промышленное L-аминокислота Ссылка применение Строительный блок для синтеза Wegman et al., 2001 полусинтетических L-фенилглицин антибиотиков

–  –  –

Боковая цепь Louwrier, Knowles, 1997 «Аспоксициллина»

D-аспарагиновая кислота 1.1.2. L-селективные аминокислотные амидазы К настоящему времени выделено и охарактеризовано пять Lаминокислотных амидаз, включая ферменты, выделенные из штаммов бактерий Mycobacterium neoaurum ATCC 25795, Pseudomonas azotoformans IAM 1603, Ochrobactrum anthropi NCIMB 40321, Brevundimonas diminuta TPU 5720 и Xanthomonas flavus NR303 (таблица 3).

L-аминоамидаза ATCC 25795 катализировала M. neoaurum энантиоселективный гидролиз -Н- и -алкилзамещенных амидов аминокислот, проявляя самое высокое сродство по отношению к D,L-алилаланинамиду, D,L--метилфенилаланинамиду и D,L-метиллейцинамиду. На основании изучения ингибирования активности было сделано предположение, что L-аминоамидаза M. neoaurum ATCC 25795 является металлозависимым ферментом (Komeda et al., 2006).

L-амидаза Ochrobactrum anthropi NCIMB 40321 конвертировала широкий ряд -Н- и,-дизамещенных -аминокислотных амидов. Кроме того, фермент катализировал гидролиз амида миндальной кислоты и Nгидроксифенилаланинамида (Sonke et al., 2005). L-амидаза O. anthropi – это металлофермент, так как его активность была ингибирована металлхелатирующими компонентами ЭДТА и фенантролином. Активность амидазы, ингибированной ЭДТА, восстанавливали ионы Zn2+ (до 80%), Mn2+ (до 400%) и Mg2+(до 560%) (Komeda et al., 2006).

L-аминокислотная амидаза Pseudomonas azotoformans IAM 1603 – фермент фермент с узкой субстратной специфичностью, проявлял активность только по отношению к L-пролинамиду, L-аланинамиду и L-метионинамиду (Komeda et al., 2004).

Komeda и Asano описали L-стереоселективную аминокислотную амидазу TPU 5720, которая проявляла Brevundimonas diminuta стереоселективность по отношению к широкому ряду L-амидов аминокислот, включая L-фенилаланинамид, L-глутаминамид, L-лейцинамид, Lметионинамид, L-аргининамид и амид L-2-аминомасляной кислоты.

Активность фермента была ингибирована ЭДТА и восстанавливалась в присутствии инов Co2+, поэтому было сделано предположение, что аминокислотная амидаза B. diminuta TPU 5720 – кобальтзависимый фермент (Komeda et al., 2006).

Asano с соавт. описали новую L-амидазу, выделенную из Xanthomonas flavus NR303, для ферментативного разделения D,L--метилцистеинамида (Inoue et al., 2005). Этот внутриклеточный фермент, названный McaA, был очищен, а кодирующий его ген клонирован. Было установлено, что ген mcaA кодирует белок из 355 аминокислот с молекулярной массой 38 кДа. Ген Lамидазы X. flavus был клонирован в E.coli JM109, клетки этого штамма были использованы для ферментативного разделения различных амидов карбоновых кислот. Фермент проявлял активность по отношению к -Н-аминокислотным амидам с L-стереоселективностю. При использовании рекомбинантных клеток был получен L--метилцистеин из E.coli соответствующего амида (40%-ная конверсия) с энантиомерным избытком более 98%.

Таблица 3 – Характеристика L-специфических амидаз различных микроорганизмов

–  –  –

1.1.3. D-селективные аминокислотные амидазы В научной литературе встречаются сведения о применении амидаз для стереоселективного синтеза ряда D-аминокислот. Катализируемый Dстереоспецифичными бактериальными амидазами гидролиз D-амидов аминокислот приводит к образованию ценных хиральных продуктов.

Ферменты, гидролизующие амиды D--Н-аминокислот, были выделены из разных микроорганизмов (таблица 4). Одним из первых таких ферментов была D-аланинамидаза Arthrobacter sp. NJ-26, выделенная японскими учеными компании Kyowa Hakko Bio Co., Ltd. Штамм был получен методом накопительной культуры на среде с D,L-аланинамидом в качестве единственного источника азота и D-циклосерином для ингибирования аланинрацемазы. Этот фермент обладал высокой активностью по отношению к D-аланинамиду (специфическая активность 1380 мкмольмг-1мин-1) и характеризовался очень узкой субстратной специфичностью. При использовании 10гл-1 сухой биомассы Arthrobacter sp.

NJ-26 и 2.4 моль D,L-аланинамида в 5-часовой реакции трансформации было получено 1.2 моль D-аланина с энантиомерным избытком более, чем 99% (Ozaki et al., 1992).

D-стереоспецифическая амидаза SV3 Ochrobactrum antropi катализировала энантиоселективный гидролиз ряда ароматических аминокислотных амидов, включая D-фенилаланинамид, D-тирозинамид и Dтриптофанамид. Ген, кодирующий данный фермент, был клонирован и экспрессирован в клетках E. coli. Было показано, что амидаза BFB40 была более термостабильна, чем фермент штамма дикого типа. C использованием фермента BFB40 был осуществлен почти полный гидролиз 1 М рацемического фенилаланинамида за 2 часа (Komeda et al., 2002).

Kula с соавт. обнаружили другую интересную D-амидазу (Krieg et al., 2005). Применяя метод накопительной культуры с D,L-tert-лейцинамидом в качестве единственного источника азота, были выделены три штамма, которые гидролизовали этот рацемический амид с D-стереоселективностью.

Амидаза Variovorax paradoxus DSM 14468 проявляла самую высокую активность, поэтому была тщательно изучена. D-амидаза V. paradoxus катализировала гидролиз не только широкого ряда -аминокислотных амидов, но и амидов карбоновых кислот, а также амидов -гидроксикислот.

Самая высокая активность была обнаружена по отношению к Dфенилаланинамиду – она была в 890 раз выше, чем к D-tert-лейцинамиду (Krieg et al., 2002). Ген, кодирующий эту D-амидазу, был клонирован и экспрессирован в E. coli (Krieg et al., 2005). Сравнение аминокислотной последовательности фермента с другими белками показало, что D-амидаза V.

paradoxus принадлежит к сигнатурному семейству амидаз, так как имеет в активном сайте каталитическую триаду Ser178, Ser154 и Lys81. В результате клонирования удалось повысить степень экспрессии D-амидазы в 120 раз. В ходе трансформации клетками E. coli в течение 4,5 часов было получено 700 мг D-tert-лейцина.

В литературе появились сообщения о новой D-стереоспецифической аминокислотной амидазе, последовательность которой на 67,9% оказалось гомологичной D-амидазе V. paradoxus. Это амидаза Delftia acidovorans, штамм был выделен из почвы методом накопительной культуры с Dфенилаланиамидом в качестве единственного источника азота. Фермент катализировал гидролиз ряда D-аминокислотных амидов, проявляя высокое сродство к субстратам с алифатическими или ароматическими боковыми цепями, такими как D-фенилаланинамид, D-триптофанамид, D-норвалинамид и D-лейцинамид. Было установлено, что D-амидаза D. acidovorans представляет собой белок из 466 аминокислотных остатков с молекулярным весом 49 кДа и принадлежит к сигнатурному семейству амидаз (Hongpattarakere et al., 2003; 2005).

D-амидазная активность была обнаружена у штамма Brevibacterium iodinum TPU 5850. Амидаза проявляла активность к широкому ряду Dаминокислотных амидов, включая D-фенилаланинамид, D-метионинамид, Dлизинамид, D-глутаминамид, D-тирозинамид, D-аргининамид, Dлейцинамид, D-пролинамид и D-аланинамид. Фермент B. iodinum TPU 5850 катализировал процесс ферментативного разделения D,L-фенилаланинамида (180мМ) в течение 3 часов с образованием D-фенилаланина (ее=99,5%) (Komeda, Asano, 2008).

У термофила Brevibacillus borstelensis BCS-1 были идентифицированы две высоко термостабильные D-аминокислотные амидазы. Dметионинамидаза эффективно гидролизовала широкий ряд Dаминокислотных амидов, самая высокая активность наблюдалась по отношению к D-метионинамиду (100%), D-норвалину (78%), D-норлейцину (77%), D-лизину (60%) и D-лейцину (59%). С использованием этого фермента из рацемического амида был получен D-фенилаланин с энантиомерным избытком 97,1% (Baek et al., 2003).

D-аланинамидаза B. borstelensis BCS-1 проявляла очень высокую активность по отношению к D-аланинамиду (активность к D-метионинамиду составляла только 6,3% от вышеупомянутой), но фермент также эффективно гидролизовал ароматические, алифатические и разветвленные аминокислотные амиды. рН-оптимум и термооптимум составили 9.0 и 85°С соответственно. Фермент полностью восстанавливал свою активность после 30 минут инкубации при 70°С. Ингибиторами выступили дитиотрейтол, меркаптоэтанол и ЭДТА, активаторами – Co2+ и Mn2+. Ген D-аланинамидазы был клонирован в E. coli. При использовании клеток рекомбинантного штамма 0,2 М D,L-фенилаланинамид был трансформирован до Dфенилаланина, причем степень конверсии составила более 99%, энантиомерный избыток 97% (Baek 2003).

et al., Таблица 4 – Характеристика D-специфических амидаз различных микроорганизмов

–  –  –

1.2.1. Иммобилизация клеток с амидазной активностью В отличие от данных, касающихся иммобилизованных биокатализаторов на основе клеток микроорганизмов с нитрилгидратазной и нитрилазной активностью, в научной литературе встречается немного сведений о получении и изучении свойств иммобилизованных биокатализаторов, обладающих амидазной активностью. Основное внимание исследователей уделяется включению содержащих амидазу клеток микроорганизмов в структуру гелей, среди которых альгинат, агар, полиакриламид, поливиниловый спирт/альгинат (Chand et al., 2004; Sogani et al., 2012).

Так, клетки Delftia tsuruhatensis CCTCC M205114, инкапсулированные в альгинат кальция, осуществляли энантиоселективный гидролиз (R)-2, 2диметилциклопропанкарбоксамида из рацемической смеси, приводя к аккумуляции S-амида, являющегося ключевым интермедиатом циластатина (Wang et al., 2010). Клетки Pseudomonas putida MTCC 6809, включенные в структуру геля альгината кальция, использовали как продуцент амидазы (Chacko et al., 2012). Образование никотиновой кислоты из никотинамида, катализируемое амидазой Microbacterium imperiale CBS 498-74, изучали в мембранном реакторе с перемешиванием (Cantarella et al., 2008). Клетки P.

aeruginosa, содержащие амидазу, иммобилизовали методом обращенных мицелл в системе катионного сурфактанта бромида тетрадецилтриметил аммония в гептане/октаноле (Bernardo et al., 2013). Клетки Pseudomonas aeruginosa L10, иммобилизованные в гранулы альгината натрия и поливинилового спирта, использовали в гидролизе ацетамида (Vieira et al., 2011).

Целые клетки Rhodococcus equi A4, проявляющие нитрилгидратазную и амидазную активность, были иммобилизованы в гранулах гидрогеля сополимера поливинилового спирта и полиэтиленгликоля LentiKats®.

Полученный иммобилизованный биокатализатор был использован для биотрансформации бензонитрила, 3-цианопиридина, (R,S)-3-гидрокси-2метиленбутанонитрила и (R,S)-гидрокси-2-метилен-3-фенилпропанонитрила до соответствующих кислот (Kub et al., 2006).

Клетки Rhodococcus sp. AJ270 иммобилизовали методом адсорбции на анионообменной смоле марки Amberlite и Dowex, а также включением в гели агара и агарозы. Оба способа иммобилизации повышали термостабильность амидазы Rhodococcus sp. AJ270 в 3-4 раза. Клетки, инкапсулированные в гранулы агара, проявляли амидазную активность, которая была в 8 раз выше у клеток, адсорбированных на Dowex (Colby et al., 2000).

1.2.2. Иммобилизация выделенных амидаз Сведения, касающиеся иммобилизации изолированной амидазы, немногочисленны. Для иммобилизации амидазы применяли включение в гели полимеров синтетического и природного происхождения, адсорбцию, ковалентное присоединение к носителю, образование поперечно-сшитых ферментных агрегатов. Термостабильная амидаза Geobacillus pallidus RAPc8, Eupergit®С иммобилизованная в гранулы полиакрилатного полимера (Degussa Rhm Gmbh&Co, Германия), катализировала D-селективный гидролиз лактамида.

При этом сохранялось до 80% амидазной активности, и была отмечена высокая степень связывания фермента с гранулами Эупергита (Makhongela et al., 2007). Пенициллинамидаза, иммобилизованная в гранулы полимера Эупергит, была использована в промышленном масштабе (Cacaval 2012). Конъюгированная с декстраном et al., пенициллинамидаза была ковалентно связана с активированными аминогруппами диоксидом кремния, что способствовало увеличению ее термостабильности (Burteau et al., 1989). Коиммобилизованная на колонке из бутилсефарозы амидаза Rhodococcus erythropolis совместно с нитрилазой Aspergillus niger осуществляли гидролиз 4-цианопиридина в изоникотиновую кислоту (Vejvoda et al., 2006). Поперечно-сшитые ко-агрегаты амидазы R.

erythropolis и бычьего сывороточного альбумина, образованные осаждением сульфатом аммония и поперечной сшивкой глутаровым альдегидом, оставались стабильными при повышении температуры до 50°С и в диапазоне рН от 5 до 12 (Park et al., 2010).

Таким образом, иммобилизация, как целых клеток, так и ферментного препарата приводит к повышению стабильности фермента и, следовательно, к многократному увеличению количества продукта реакции.

1.3. Факторы, влияющие на стереоселективность ферментов Стереоселективность – преимущественное образование в химической реакции одного стереоизомера над другим. Если образующиеся стереоизомеры являются энантиомерами, то данное явление называется энантиоселективностью, если стереоизомерные продукты являются диастереомерами – диастереоселективностью. Количественно стереоселективность выражается при помощи энантиомерного избытка, который определяется уравнением:

, где Х и У – доли энантиомеров. Таким образом, энантиомерный избыток – это мера превышения количества одного энантиомера над другим.

Ферменты обладают исключительно высокой регио- и энантиоселективностью, катализируют реакции с образованием оптически активных соединений. Однако выход целевого продукта и его оптическая чистота зависят от условий, в которых протекает стереоселективная реакция (Потапов, 1988).

Структура субстрата Наиболее важным фактором для проявления селективности фермента является структура субстрата, его ориентация в активном сайте. На соотношение энантиомеров также влияет концентрация субстрата (Kinoshita, 1996).

Изучено влияние заместителей и их положение на энантиоселективность амидазы. Wu с соавт. исследовали асимметричный гидролиз,-дизамещенных малонамидов до энантиомерно чистых R-,дизамещенных малоновых кислот с использованием штамма Rhodococcus sp.

CGMCC. Оказалось, что среди субстратов с ароматическим кольцом в качестве заместителя в орто-, мета- или пара-положении самая высокая величина энантиомерного избытка наблюдалась в результате гидролиза субстратов с заместителем в пара-положении (Wu, Li, 2003).

Структура субстрата может вызвать инверсию стереоселективности фермента. Например, фермент Ochrobactrum anthropi LMG7991 известен как L-аминопептидаза/D-аланинэстераза/амидаза, гидролизующий Dконфигурации аланиновых субстратов (аланин-р-нитроанилид, аланинамид и метиловый эфир аланина), по отношению к ди- и трипептидам проявляет Lстереоспецифичность. Липазы Rhizomucor miehei и Humicola lanuginose проявляли разную энантиоселективность к эфирам 2-метилдекановой кислоты. Оба фермента гидролизовали преимущественно S-энантиомер 1гептил 2-метилдеканоата и в то же время R-энантиомер фенил 2метилдеканоата (Holmquist et al., 1993).

Пенициллинчувствительные D-пептидазы проявляют строгую Dспецифичность к ди- и трипептидам. Также эти ферменты гидролизуют различные эфиры и их аналоги. Так, D-пептидаза Actinomadura R39 гидролизовала тиоловые эфиры, чьи С-терминальные группы находились в L-конфигурации (Damblon et al., 1995).

Состав реакционной среды Естественной средой для ферментов являются водные растворы, где фермент поддерживает свою нативную конформацию и природную активность. Однако некоторые субстраты нерастворимы в воде, поэтому в качестве реакционной среды используют органические растворители, в различной степени обводненные (Klibanov, Cambou, 1987). Необходимым условием биокатализа в органической среде является сохранение активной конформации фермента. Взаимодействие субстрата и растворителя может вызвать снижение родства субстрата к активному сайту фермента, что приведет к значительному снижению ферментативной активности (Bell et al., 1995; Klibanov, 1997). Кроме того, в органической среде фермент гидратируется не полностью, он может сформировать ригидную структуру, что также приведет к снижению его активности (Zaks, Klibanov, 1988; Broos 1995). Повысить гидратацию фермента, а, следовательно, et al., ферментативную активность и энантиоселективность, можно добавлением небольших количеств воды к органическим растворителям.

Различные растворители могут оказывать как положительное, так и отрицательное влияние на ферментативную активность, стабильность и селективность, это зависит от субстрата, фермента и реакционной среды (Kitaguchi 1989; Fitzpatrick, 1991). Было показано, что et al., энантиоселективность липазы, была выше при использовании алифатических растворителей, чем при использовании ароматических (Nakamura et al., 1995). Присутствие органического растворителя в среде может также привести к полной потере энантиоселективных свойств фермента (Tawaki, Klibanov, 1992; Wescott, Klibanov, 1993).

Таким образом, влияние растворителя является решающим в энзиматической реакции. Многие авторы пытаются связать изменение энзиматической селективности с физико-химическими свойствами растворителя такими, как диэлектрическая константа и дипольный момент.

Однако невозможно вывести какое-либо общее правило, которое объясняло бы корреляцию между этими параметрами и селективностью фермента.

Систематические исследования реакции этерификации в присутствии различных растворителей, катализируемой липазой Burkholderia cepacia, показали, что влияние одного и того же растворителя на разные субстраты различно. Другими словами, лучший растворитель для одного субстрата будет худшим для другого (Carrea et al., 1992).

Кроме того, исследования корреляции между физико-химическими свойствами растворителя привели к появлению трех теорий, объясняющих влияние органической среды на селективность фермента. Первая предполагает, что селективность может измениться, если молекулы растворителя связываются с активным центром фермента, поэтому меняется взаимодействие между ферментом и субстратом (Secundo et al., 1992;

Nakamura et al., 1991). Вторая теория предполагает, что растворитель может модифицировать конформацию фермента, тем самым изменяя способ процесса молекулярного распознавания субстрата ферментом (Wu et al., 1991). Третья теория предполагает зависимость селективности от энергетики растворения субстрата (Ke et al., 1996; Wescott et al., 1996).

Температура и рН Температура и рН оказывают значительное влияние не только на активность фермента, но и на его энантиоселективность.

Wang с соавт. показали, что путем изменения рН среды можно добиться повышения энантиомерной чистоты получаемого продукта.

Изменение рН буфера с 7.62 до 7.13 привело к повышению энантиоселективности нитрилазы, которая катализировала гидролиз D,Lфенилглицинонитрила (Wang et al., 2001).

В другой работе авторы продемонстрировали влияние температуры на энантиоселективность. Понижение температуры реакции с 30° до 20°С приводило к увеличению энантиоселективных свойств фермента Rhodococcus sp. AJ270, катализировавшего синтез оптически активной 2,2диметилциклопропановой кислоты (Wang et al., 2002).

Стереоспецифичность амидазы D. tsuruhatensis ZJB-05174 оказалась полностью зависимой от температуры. С повышением температуры реакции с 30° до 46°С наблюдали снижение энантиоселективности фермента в 5 раз.

Когда температура достигла 56°С, фермент потерял стереоспецифичность (Zheng et al., 2012). Это явление можно объяснить влиянием температуры на свободную энергию активации энантиомеров, которая подразделяется на энтальпический и энтропический компоненты (Pepechalov et al., 2001).

Влияние иммобилизации Данных о влиянии иммобилизации на стереоселективные свойства ферментов имеется немного. В результате иммобилизации селективность может повышаться, снижаться или оставаться неизменной. Очевидно, что каждый специфичный фермент будет вести себя по-разному, каждый способ иммобилизации будет давать различный эффект.

Показано снижение энантиоселективных свойств нитрилазы DSMZ, катализирующей гидролиз рацемического Alcaligenes faecalis манделонитрила, при иммобилизации фермента путем включения в альгинатные гранулы (Kaul et al., 2006), тогда как получение поперечносшитых ферментных агрегатов того же штамма приводило к стабилизации энантиоселективности и температурной устойчивости (Kaul et al., 2007).

Энантиоселективное ингибирование Некоторые ингибиторы, связываясь с аллостерическим участком фермента, вызывают конформационные перестройки в его активном сайте. В результате активность и селективность фермента может снижаться или повышаться. Например, декстрометорфан и левометорфан увеличивали энантиоселективность липазы Candida rugosa. Эти соединения ингибировали трансформацию одного энантиомера, что приводило к увеличению скорости трансформации другого энантиомера (Guo, Sih, 1989). Было обнаружено, что L-метионинол повышал скорость гидролиза R-энантиомера 3ацетоксинитрилов, катализируемого липазой Pseudomonas sp., тогда как гидролиз S-энантиомера он ингибировал. Можно сделать предположение, что субстрат и L-метионинол были связаны с ферментом в разных сайтах, и конформационные изменения, происходящие в результате связывания с Lметионинолом, вызвали изменение сродства фермента по отношению к субстрату (Itoh et al., 1991).

Таким образом, стереоселективность является не только специфическим свойством фермента, но и результатом влияния различных факторов среды, таких, как рН, температура, метод иммобилизации фермента, структура субстрата.

1.4. Энантиоселективная биотрансформация D,Lфенилглицинонитрила Энантиомеры фенилглицина являются ключевыми интермедиатами в синтезе полусинтетических антибиотиков. Некоторые пенициллины и цефалоспорины содержат D-фенилглицин (ампициллин и цефалоспорин) (рисунок 4) и D-гидроксифенилглицин (амоксициллин) в качестве боковых цепей (рисунок 5) (Alonso et al., 2007; 2008; Bruggink, 2001). Эти неприродные аминокислоты обладают высокой устойчивостью к протеолитическому воздействию, тем самым препятствуют развитию бактериальной резистентности.

L-фенилглицин также является важным строительным блоком для получения некоторых антибиотиков (Liu et al., 2014), интермедиатом в синтезе медицинских и фармацевтических препаратов, например, таксола – противоракового препарата (Hensel et al., 2002). L-фенилглицин – стартовый материал для получения метилового эфира L-аспартил-L-фенилглицина, который используется в качестве сахарозаменителя (Moriarty et al., 1976).

Рисунок 4 – D-фенилглицин в составе А – ампициллина, Б – цефалексина (Bruggink, 2001).

Рисунок 5 – D-p-гидроксифенилглицин в составе амоксициллина (Alonso et al., 2007).

Для получения L- или D-энантиомеров фенилглицина возможны два пути: химический синтез с последующим разделением рацемической смеси и энантиоселективная биотрансформация предшественников.

Химический способ получения D-фенилглицина начинается с синтеза рацемического фенилглицина в реакции Штрекера из бензальдегида, циановодорода и аммония. Далее получают диастереомерную соль рацемата и разделяют ее методом кристаллизации. В качестве разделяющего агента используется камфорсульфоновая кислота (рисунок 6, А) (Sheldon, 1993).

Однако, получение энантиомерно чистого D- или L-фенилглицина методом разделения рацематов – экономически невыгодный, трудоемкий и длительный процесс. Успех химического разделения зависит от вида и количества применяемого растворителя, температуры кристаллизации и легкости отщепления вспомогательного вещества от диастереомерной соли.

Только в исключительных случаях выделение оптически чистого энантиомера удается без последующей перекристаллизации. Кроме того, данный метод требует применения камфорсульфоновой кислоты дорогостоящего агента расщепления (May et al., 2002).

D-фенилглицин может быть также получен в результате ферментативного разделения рацемической смеси. D-специфическая гидантоиназа катализирует гидролиз рацемического фенилгидантоина до DN-карбамоилфенилглицина. Последний в присутствии азотистой кислоты превращается в D-фенилглицин (рисунок 6, Б) (Gokhale et al., 1996).

Рисунок 6 – Способы получения D-фенилглицина: А – метод химического синтеза, Б – ферментативное разделение с использованием D-специфической гидантоиназы (Sheldon, 1993).

Хемо-энзиматический синтез D-фенилглицина с использованием гидантоиназы не нашел большого распространения по ряду причин: выход процесса составляет всего 50%, образующийся D-N-карбамоилфенилглицин необходимо трансформировать в D-фенилглицин, что требует наличия сильнокислой среды.

Разработан еще один способ получения энантиомеров фенилглицина.

Энзиматический гидролиз D,L-фенилглицинонитрила, катализируемый нитрилгидратазно-амидазной системой, ведет к получению как D-, так и Lизомера фенилглицина в зависимости от стереоспецифичности используемой амидазы:

Рисунок 7 – Гидролиз D,L-фенилглицинонитрила (D,L-ФГН) через D,Lфенилглицинамид (D,L-ФГА) нитрилгидратазой и амидазой (Wegman et al., 2001; Wang et al., 2001).

Такой гидролиз способны осуществлять виды Rhodococcus, которые обладают неселективной нитрилгидратазой и L- или D-специфичной амидазой. Штаммы MAWA, MAWB, MAWE, MAWC и MAWD синтезировали нитрилгидратазу, которая конвертировала нитрил до амида, и L-специфичную амидазу, которая гидролизовала накапливающийся амид до L-кислоты (Wegman et al., 2001). В результате оптимизации условий роста полученных культур, был отобран штамм R. globerulus MAWA, который в течение 5 минут катализировал гидролиз D,L-фенилглицинонитрила с образованием 48% D-фенилглицинамида (ее – 99%) и последующий 4часовой гидролиз амида с образованием 52% L-фенилглицина (ее – 97%) (Wegman et al., 2001).

Штамм Rhodococcus sp. AJ270, обладающий нитрилгидратазной и амидазной активностью, способен гидролизовать широкий ряд рацемических

-замещенных фенилацетонитрилов и 2-арилциклопропанкарбонитрилов с высокой энантиоселективностью (Meth-Cohn et al., 1997; Wang et al., 2000).

Данный штамм был использован для энантиоселективной биотрансформации D,L-фенилглицинонитрила. После реакции в течение 2,5 часов был получен D-фенилглицинамид (ее=74%) и L-фенилглицин (ее=93%) (Wang et al., 2001).

Выделен и идентифицирован штамм Pantoea endophytica, который синтезировал S-фенилглицин (ее99%) в результате гидролиза Sфенилглицинамида.

Синтез R-фенилглицина (ее99%) был достигнут при использовании другого штамма Pantoea sp., обладающим R-селективной амидазой. Nocardioides sp. гидролизовал рацемический фенилглицинонитрил до S-фенилглицинамида (ее=52%) без последующего гидролиза в кислоту изза отсутствия амидазной активности (Hensel et al., 2002). Aspergillus fumigatus с помощью нитрилазы катализирует гидролиз D,L-фенилглицинонитрила до L-фенилглицина с энантиомерным избытком 80% (Choi et al., 1986; Lee et al., 1988).

Клетки Pseudomonas aeruginosa 10145 использовали в качестве биокатализатора в трансформации 2-фенил-2-аминоацетонитрила до Dфенилглицина. После реакции в течение 1 часа было получено 18% Dфенилглицина с энантиомерным избытком 95% (Alonso et al., 2008). Чтобы повысить биокаталитический потенциал, клетки Ps. aeruginosa 10145 были включены в 1,5%-ный альгинат кальция. 20%-ная конверсия 2-фенил-2аминоацетонитрила до D-фенилглицина была достигнута в результате 3часовой реакции (ее98%). Иммобилизованный фермент использовали в 4-х циклах, в ходе которых сохранялась биокаталитическая активность (Alonso et al., 2007).

Таким образом, энантиоселективная биотрансформация D,Lфенилглицинонитрила с использованием нитрилгидролизующих ферментов является перспективным методом получения изомеров фенилглицина.

1.5. Биотрансформация фенилаланинамида Фенилаланин – ароматическая аминокислота, которая существует в двух оптически изомерных формах L и D. Потребность в этой аминокислоте очень велика. Фенилаланин используется для сбалансирования кормов животных, как компонент спортивного питания. Значительная часть фенилаланина идёт на производство дипептида аспартама — синтетического сахарозаменителя, активно использующегося в пищевой промышленности (Kamphuis et al., 1990).

До недавнего времени единственным методом лечения болезни Паркинсона было хирургическое вмешательство в область головного мозга.

Сейчас найдено эффективное лекарство — 3,4-диоксифенилаланин (ДОФА) и его производные. L-метил-3,4-дигидроксифенилаланин используют в качестве исходного вещества для синтеза Эналаприла – лекарственного препарата против гипертензии. D-фенилаланин является основой противодиабетического лекарственного средства (James, 2003).

Получение фенилаланина возможно методами прямого микробиологического синтеза (Khamduang et al., 2009), либо методами биотрансформации с использованием предшественников, в качестве которых рассматриваются коричная кислота (Yamada et al., 1981), фенилпируват (Miller 1987). Использование для синтеза фенилаланина et al., предшественников считается наиболее перспективным в силу более высоких достигаемых концентраций целевого продукта и большей скорости реакции.

Энантиомеры фенилаланина также получают ферментативным расщеплением рацемических предшественников аминокислоты:

производных гидантоина (Zhou et al., 2011), эфиров и амидов фенилаланина (Komeda et al., 2006; Komeda et al., 2003), ацетилпроизводных (Hermes et al., 1993). С открытием D-стереоспецифических ферментов появилась возможность получения не только L-, но и D-энантиомеров аминокислот, которые ранее получали исключительно химическим синтезом. В связи с этим, энзиматические методы приобрели большую популярность (Leuchtenberger et al., 2005).

ГЛАВА 2. ОБЪЕКТЫ И МЕТОДЫ ИССЛЕДОВАНИЯ

2.1. Объекты исследования Объектом исследования явились штаммы, выделенные из образцов антропогенно-загрязненной почвы, а также штаммы лабораторной коллекции, обладающие амидазной активностью. Образцы почвы были отобраны на территории Подольского завода цветных металлов и предоставлены сотрудниками кафедры физиологии растений и микроорганизмов (ПГНИУ, Пермь).

Для дальнейших исследований были отобраны два штамма Arthrobacter sp. 6-1 и R. rhodochrous 4-1, обладающие амидазной активностью и стереоселективностью.

2.2. Выделение и идентификация амидгидролизующих бактерий Штаммы выделяли методом прямого высева. Навеску почвы (1,0 г) суспендировали в 100 мл стерильного фосфатного буфера, оставляли при температуре 28°С при постоянном перемешивании со скоростью вращения 120 об/мин на 1 час. Полученный раствор использовали для разведений и последующего параллельного высева на чашки Петри с агаризованной средой N, содержащей селективный субстрат – лактамид в концентрации 10 мМ. На 3-7 сутки роста отбирали среди образовавшихся колоний наиболее крупные, а также морфологически различающиеся переносили на чашки Петри со свежей селективной средой. Чистую культуру пересевали в колбы с жидкой средой аналогичного состава и культивировали в течение 5-7 суток.

Селекцию проводили на минеральной среде N с добавлением лактамида до конечной концентрации 50 мМ в качестве единственного источника углерода и азота.

Предварительную идентификацию штаммов, проявляющих амидазную активность, проводили путем ПЦР-анализа с праймерами к генам 16S рРНК, сконструированными на основе последовательностей, представленных в базе данных GenBank и синтезированными ООО «Евроген», г. Москва (таблица 5).

–  –  –

Идентификацию штамма Arthrobacter sp. 6-1, отобранного для дальнейших исследований, проводили на основании культуральноморфологических и биохимических характеристик согласно определителю бактерий Берджи (Хоулт, 1997).

Морфологию и жизненный цикл изучали у 12-72 часовой культуры, выращенной на агаризованной среде LB с использованием фазовоконтрастной микроскопии.

Для изучения физиолого-биохимических признаков культуру 6-1 выращивали в аэробных условиях на среде LB.

Гидролиз эскулина Культуру выращивали на агаризованной среде LB с добавлением 0,01%-ного эскулина и 0,05%-ного лимоннокислого железа. При гидролизе эскулина среда приобретает черный цвет. Наблюдали отсутствие роста культуры и неизменную окраску среды.

Гидролиз желатины Культуру выращивали на агаризованной среде LB с добавлением 1%ного желатина и индикатора фенолового красного. Наблюдали гидролиз желатины с образованием розовой окраски среды.

Гидролиз крахмала Культуру 6-1 высевали на агаризованную среду с добавлением 0,2%ного растворимого крахмала, после инкубации агар заливали раствором иода.

При положительном тесте вокруг зоны роста появляется бесцветный участок.

Гидролиз крахмала не наблюдали.

Утилизация цитрата Готовили цитратный агар Симмонса, содержащий в качестве единственного источника углерода цитрат натрия и бромтимоловый синий в качестве индикатора. Рост культуры сопровождался появлением голубой окраски среды, означающей утилизацию цитрата.

Ферментация углеводов К минеральной среде Смита, содержащей бромтимоловый синий в качестве индикатора, добавляли 1%-ный сахар (лактозу, глюкозу, сахарозу).

Использования сахаров и подкисления среды не наблюдали.

Уреазный тест Готовили агар Кристенсена с мочевиной и индикатором феноловым красным. На наличие уреазы, которая расщепляет мочевину до аммиака и углекислого газа, указывает окрашивание среды в красно-фиолетовый цвет.

Оксидазный тест В оксидазном тесте использовали бесцветный краситель фенилендиамин дигидрохлорид, используемый как искусственный акцептор электронов, который при участии оксидазы окисляется и образует окрашенное вещество индофенол синий.

Тест на каталазу На исследуемую колонию наносили 1-2 капли 3%-ной перекиси водорода и наблюдали появление пузырьков, что свидетельствует об образовании кислорода и наличии каталазы.

Тест на липазу Готовили агаризованную среду с добавлением 0,01%-ного хлорида кальция и 1%-ного твина 80, засевали штрихом. Наблюдали появление мутного ореола вокруг колоний, означавшего образование кристаллов кальциевого мыла.

2.3. Среды и субстраты для культивирования Бактериальные штаммы культивировали на синтетической среде N следующего состава (г/л): KH2PO4 - 1.0; K2HPO43H2O - 1.6; NaCl - 0.5;

MgSO47H2O - 0.5; CaCl2 - 0.005; CoCl26H2O – 0.01; FeSO47H2O - 0.005;

рН 7.2 ± 0.2 (Максимов и др., 2003). Агаризованную среду получали добавлением бакто-агара (Sigma) до конечной концентрации 1,5 %.

В качестве источника углерода для штамма R. rhodochrous 4-1 использовали глюкозу в конечной концентрации 0,1%. В качестве источника азота – ацетонитрил в концентрации 10 мМ. Источники углерода и азота для штамма Arthrobacter sp. 6-1 варьировали.

Бактериальный рост оценивали по изменению оптической плотности суспензии клеток при =540 нм с учетом разведения на фотоэлектроколориметре КФК-3, либо на спектрофотометре Ultrospec 3300 pro с использованием с использованием кварцевой кюветы (длина пути 1 см).

Соответствие единицы ОП весу сухих клеток определяли для каждого штамма взвешиванием на аналитических весах предварительно высушенной биомассы из 1 мл суспензии известной ОП.

2.4. Определение амидазной активности и стереоселективности штаммов Удельную активность клеток определяли как количество акриловой кислоты в мкмоль, образуемое за 1 минуту биомассой бактерий, соответствующей 1 мг сухого веса. Удельную активность фермента рассчитывали на 1 мг белка. Единица амидазной активности клеток (1 ЕД) соответствует 1 мкмоль кислоты/мг клеток/мин, в случае амидазной активности ферментного препарата – 1 мкмоль кислоты/мг белка/мин.

Амидазную активность бактериальной суспензии и ферментного препарата предварительно оценивали спектрофотометрически (Ultraspec

3000) по возрастанию оптической плотности реакционной среды при проведении минутной реакции с акриламидом в качестве субстрата при =230 нм (Кузнецова, 2004).

Стереоселективные свойства штаммов определяли путем трансформации D,L-лактамида, D- и L-изомеры молочной кислоты анализировали спектрофотометрически на планшетном ридере Tecan infinite M200 pro (“Tecan”, Швейцария) при использовании набора реактивов для энзиматического определения D- и L-молочной кислоты (“R-Biopharm”, Германия), следуя инструкциям производителя.

Энантиомерный избыток (ее) рассчитывали по формуле, где Х и У – доли энантиомеров. При этом суммарную концентрацию энантиомеров молочной кислоты принимали за 100%.

2.5. Выделение амидазы Клеточную суспензию центрифугировали 10 мин со скоростью вращения 10000 g, клеточный осадок отмывали фосфатным буфером, содержащим 44 мМ бутират натрия. Осадок клеток ресуспендировали в 10 мл фосфатного буфера, содержащего бутират натрия в указанной концентрации.

Озвучивание клеток проводили на ультразвуковом дезинтеграторе при 22 кГц 10 раз по 15 секунд с охлаждением на льду. Суспензию, содержащую разрушенные клетки, центрифугировали 20 мин при скорости вращения 10000 g с охлаждением (4°С).

Высаливание белка осуществляли следующим образом: к 10 мл надосадочной жидкости добавляли 2,08 г сульфата аммония (концентрация сульфата аммония составляет 35% от насыщения) и центрифугировали 20 мин при 10000 g с охлаждением. В результате чего образовался осадок, который растворили в 10 мл фосфатного буфера, содержащего бутират натрия. К 10 мл надосадочной жидкости добавили 1,63 г сульфата аммония (концентрация сульфата аммония составляет 60% от насыщения) и центрифугировали 20 мин при 10000 g с охлаждением. Образовавшийся осадок растворили в 10 мл фосфатного буфера, содержащего бутират натрия.

На каждом этапе после растворения осадка спектрофотометрически измеряли амидазную активность по отношению к акриламиду. По активности определяли, в какой пробе находится амидаза. Высаливание амидазы происходило при добавлении сульфата аммония до 60% от насыщающей концентрации. Ферментный препарат хранили при -18°С.

Концентрацию белка определяли по методу Бредфорда. Реагент Бредфорда готовили следующим образом: 50 мг Кумасси G-250 растворили в 25 мл 96% этилового спирта, добавили 50 мл ортофосфорной кислоты, довели до 500 мл дистиллированной водой и профильтровали через бумажный фильтр.

0,25 0,2 0,15 ОП 595 0,1 0,05

–  –  –

Рисунок 8 – Калибровочный график для определения концентрации белка в растворе по методу Бредфорда (Bradford, 1976).

Делали калибровку по бычьему сывороточному альбумину (рисунок 8).

К 1 мл пробы добавляли 1 мл реагента Кумасси, выдерживали в течение 5 мин для развития окраски, измеряли оптическую плотность при =595 нм. По калибровочному графику рассчитывали концентрацию белка в пробе.

2.6. Иммобилизация Адсорбцию клеток с амидазной активностью проводили в течение 2 часов при 22С из 10 мл бактериальной суспензии на 500 мг активного угля БАУ (ООО “УралХимСорб”, Россия). Массу клеток в мл суспензии определяли взвешиванием на аналитических весах предварительно высушенной до постоянного веса биомассы в известном объеме суспензии.

Количество адгезированных клеток определяли по формуле:

А = (ОПисх – ОПфильтр) / ОПисх m, где: А – количество адгезированных клеток, мг; ОПисх – оптическая плотность суспензии клеток до адсорбции, измеренная при длине волны 540 нм; ОПфильтр – оптическая плотность суспензии клеток после адсорбции; m – концентрация клеток в суспензии до адсорбции, мг/мл. Носитель с адгезированными клетками отмывали калий-фосфатным буфером.

Иммобилизацию ферментного препарата осуществляли следующими методами: методом ковалентной сшивки с хитозаном, методом адсорбции и методом поперечно-сшитых агрегатов (ПСФА).

Для иммобилизации амидазы методом ковалентной сшивки с хитозаном готовили 2%-ный (вес/об.) раствор хитозана в 2%-ной (об./об.) уксусной кислоте. Гранулы готовили следующим образом: 2 мл 2%-ного хитозана накапывали через иглу шприца в 1М раствор KOH объемом 5 мл. В этом растворе гранулы затвердевали в течение 40 мин, далее их промывали фосфатным буфером 3 раза по 10 мл до нейтральной реакции промывных вод. Активацию гранул проводили 0,1%-ным бензохиноном в течение 15 минут. Затем гранулы промывали фосфатным буфером 3 раза по 10 мл. К хитозановым гранулам добавляли 2 мл ферментного препарата, выдерживали 40 мин при температуре 22-24°С, промывали фосфатным буфером до исчезновения белка в промывных водах.

Концентрацию связанного белка определяли по разности концентрации белка в растворе до и после контакта с гранулами:

Асорб = (Аисх – Афильтр)х M Асорб – связанный белок, мг Аисх – концентрация белка в растворе до адсорбции, мг/мл Афильтр – концентрация белка в растворе после адсорбции, мг/мл М – количество раствора, мл.

Процент сорбции вычисляли по следующей формуле:

Ссорб = (Асорб / Сисх) х 100% Ссорб – адсорбция, % Асорб – связанный белок, мг Сисх – количество белка в растворе до адсорбции, мг.

Для иммобилизации амидазы методом адсорбции использовали углеродсодержащие носители: мезопористый Сибунит, Sуд = 441 м2/г (Институт катализа им. Г.К. Борескова СО РАН, г. Новосибирск, Россия) и Сферический углерод-минеральный сорбент (СУМС), Sуд = 220 м2/г (Россия) (Коваленко и др., 2007). Раствор белка (2 мл) инкубировали с 200 мг носителя при 22–25°С в течение 2 часов на шейкере со скоростью вращения 100 об/мин, носитель отмывали 0,01 М калий-фосфатным буфером, рН 7,2 ± 0,2 до исчезновения белка в промывных водах. Количество адсорбированного белка определяли по разности концентрации белка в растворе до и после контакта с носителем.

Поперечно-сшитые ферментные агрегаты получали фракционированием белка сульфатом аммония как описано выше с одновременной обработкой 0,1%-ным раствором глутарового альдегида, либо 0,1%-ным раствором бензохинона.

2.7. Определение продуктов реакции трансформации нитрилов и амидов Трансформацию нитрилов и амидов изолированной амидазой проводили в 10 мМ калий-натрий фосфатного буфера, рН 7,2, при начальной концентрации субстрата 10-50 мМ. Реакцию проводили в течение 60 мин и останавливали добавлением концентрированной HCl до конечной концентрации в растворе 5%. Пробы центрифугировали при 10000 g в течение 10 мин. Продукты реакции анализировали методами ТСХ и ВЭЖХ.

Восходящую тонкослойную хроматографию продуктов трансформации фенилаланинамида проводили на пластинках Сорбфил (АО «Сорбполимер», г. Краснодар).

Из четырех апробированных вариантов составов подвижных фаз (ацетон-вода-уксусная кислота-муравьиная кислота, бутанол-водауксусная кислота, вода-пропанол-аммиак, бутанол-ледяная уксусная кислотавода) эффективное разделение исследуемых веществ наблюдалось в системе:

вода-пропанол-аммиак (1:8:1). Исследуемые вещества на хроматограмме обнаруживали путем опрыскивания пластинок 0,1%-ным раствором нингидрина в этиловом спирте и последующем нагревании при 110°С в течение 10 мин.

Количественный анализ субстратов и продуктов реакции трансформации нитрилов и амидов аминокислот проводили методом ВЭЖХ при использовании жидкостного хроматографа “Shimadzu LC-10A” (Япония), оснащенного диодной матрицей. Концентрацию акриламида и акриловой кислоты определяли на колонке Synergi 4u Hydro–RP 80A (250 4.

6 мм). В качестве подвижной фазы использовали 25 мМ NaH2PO4, скорость потока составляла 0,75 мл/мин при 25°C, детекцию проводили при длине волны 200 нм. Концентрацию фенилглицинонитрила, L-фенилглицина, фенилаланинамида и фенилаланина определяли на колонке CROWNPAK® CR(-). В качестве элюента использовали раствор HClO4 (pH 2,0) и 10%-ного метанола, скорость потока составляла 0,3 мл/мин при 30°C, детекцию проводили при длине волны 210 нм. Количественные данные были получены при сравнении со стандартной кривой известных концентраций исследуемых соединений.

2.8. Выделение ДНК и полимеразная цепная реакция Препараты хромосомной ДНК получали фенольным методом, модифицированным для выделения ДНК из актиномицетов. Для этого колонии бактерий переносили в пробирки для микроцентрифугирования типа эппендорф, ресуспендировали в 0,5 мл раствора SSC (NaCl 0,15 М, цитрат натрия 0,015 М, лизоцим 5 мг), выдерживали при 37С в течение 30 мин.

Добавляли 50 мкл 20%-ного раствора SDS, перемешивали и выдерживали в течение 10 мин при 65С в твердотельном термостате Термит (Россия).

Добавляли 0,5 мл фенола и центрифугировали при 10000 g в теченние 10 мин. Супернатант (водную фазу) переносили в чистую микропробирку, добавляли равный объем (0,5 мл) хлороформа, перемешивали и центрифугировали при 10000 g 3 мин. Водную фазу переносили в чистую микропробирку и добавляли равный объем изопропанола (0,5 мл), центрифугировали при 10000 g 3 мин. Полученную смесь выдерживали при

-18С в течение 1 ч и центрифугировали в течение 5 мин при 10000 g.

Полученный осадок высушивали и растворяли в 100 мкл ТЕ-буфера (10 мМ трис-HCl, 1 мМ ЭДТА, рН 8,0).

Амплификацию ДНК проводили с применением термостабильной Taqполимеразы производства ООО «СибЭнзим» (Новосибирск) на термоциклере Т3 (Biometra, Германия). Олигонуклеотидные праймеры, специфичные к генам известных D-аминокислотных амидаз, были разработаны с использованием баз данных GenBank по заданным последовательностям и синтезированы в Мировой лаборатории «Микробных и клеточных биотехнологий», Пермь (таблица 6).

Режим амплификации для праймеров, специфичных к генам Dаминокислотных амидаз включал: денатурацию – 60 сек при 94С, отжиг – 60 сек при 56С для праймеров BrIDAA, при 57С – для праймеров BrDAA и при 50С для праймеров OchDAA; элонгацию – 80 сек при 72С (35 циклов);

в завершающем цикле – дополнительно 60 сек при 72С.

Таблица 6 – Праймеры для ПЦР-анализа генов D-аминокислотных амидаз Выявляемые гены Праймер Последовательность D-амидаза, гомологичная ферменту из ATGAGCGATTTGAAATTCGATGGAC BrIDAA Brevibacterium iodinum TCAGAGGAACCGGTGGATCGC (AB233405.1) D-амидаза, гомологичная

GTTGCTGGCTCAACAACTTGG

ферменту из Brevibacillus BrDAA

ACAGTAGCCCCACCAATTCCC

borstelensis (AF441121.1) D-амидаза, гомологичная ферменту из ATGAGTGATTTGAACAACGC OchDAA Ochrobactrum anthropi CTAACTGCGGGAGTTTT (AB026907.1) Электрофоретическое разделение продуктов ПЦР-реакции проводили в 1,2-1,5%-ном агарозном геле в трис-боратном буфере при напряженности поля 5 В/см. Для оценки молекулярной массы фрагментов ДНК использовали молекулярные маркеры 1 kb и 100 b (ООО «СибЭнзим» и Axigen®).

Визуализацию полос и документирование данных осуществляли после окрашивания геля бромистым этидием с использованием системы гель-документации BioDocAnalyze (Biometra, Германия).

2.9. Секвенирование ДНК Очистку ПЦР-продукта перед секвенированием осуществляли двумя способами:

1) с использованием смеси ферментов ExoSAPMix (Fermentas Life Sciences): Exonuclease I(Exo I) - 1мкл, Shrimp Alkaline Phosphatase - 10 мкл, деионизованная вода - 89 мкл. Обработка ПЦР-продуктов: 2 мкл ExoSAPMix на 25 мкл ПЦР-продукта. Инкубация при 37°С 40 мин, 85°С - 15 мин;

2) путем гель-электрофореза с помощью аппарата E-Gel (Invitrogen) согласно инструкции фирмы-производителя.

Секвенирующую реакцию проводили в следующей реакционной среде:

Big Dye Terminator (Applied Biosystems, США) - 8 мкл, очищенный ПЦР продукт - 1мкл, праймер-1мкл, деионизованная вода-10 мкл. Температурный режим секвенирующей ракции: 95°С – 1 мин, 95°С - 10 сек, 50°С - 5 сек, 60°С

- 4 мин, 25 циклов.

После секвенирующей реакции проводили чистку и переосаждение образцов двумя методами:

1) с использованием Big Dye XTerminator Purification Kit (Applied Biosystems, США): 90 мкл SAM Solution+20 мкл Terminator на 20 мкл продукта. Полученную смесь встряхивали на вортексе при 10000 g в течение 30 мин., после чего осаждали центрифугированием;

2) к образцу (20 мкл) добавляли 2 мкл 7,5М ацетата аммония и 60 мкл 96%-ного этанола. Выдерживали смесь в течение 20 мин при -18°С и центрифугировали 15 мин при 10000 g. Надосадочную жидкость сливали, к осадку добавляли 100 мкл 70%-ного этанола, выдерживали в течение 2 минут при комнатной температуре и центрифугировали 15 мин при 10000 g.

После переосаждения сливали надосадочную жидкость, осадок высушивали при 50°С, растворяли в 10 мкл смеси MegaBACE Loading Solution (70% формамид, 1% ЭДТА, 29% H2О) и анализировали нуклеотидную последовательность с помощью системы секвенирования ДНК MegaBACE1000 (APBiotech).

Полученные нуклеотидные последовательности обрабатывали с помощью пакета программ MegaBACE1000 и программы Chromas lite 2.1.

Сравнение нуклеотидных последовательностей проводили с применением программ ClustalW 2.0.9 и YACWGUI 1.2. Для построения графического изображения филогенетического древа использовали программу YACWGUI 1.2.

2. 10. Статистическая обработка Все эксперименты проводились не менее чем в трехкратной повторности. При статистической обработке определяли среднее арифметическое, стандартное отклонение и доверительные интервалы.

Достоверность различий определяли с использованием t-критерия Стьюдента (Лакин, 1990). Различия считались значимыми при р0,05.

Анализ результатов проводили с помощью прикладных программ MS Office XP Excel и Statistica 5.0.

ГЛАВА 3. ИССЛЕДОВАНИЕ КУЛЬТУРАЛЬНЫХ И

СТЕРЕОСЕЛЕКТИВНЫХ СВОЙСТВ ШТАММОВ R. rhodochrous 4-1 и Arthrobacter sp. 6-1

3.1. Выделение и селекция штаммов, способных к стереоселективной трансформации D,L-лактамида1 С целью выделения амидгидролизующих бактерий были взяты почвенные образцы, отобранные на территории Подольского завода цветных металлов.

Для первичного отбора микроорганизмов использовали минеральную среду N, содержащую в качестве селективного субстрата 50 мМ лактамид.

Клоны микроорганизмов, способных к утилизации лактамида, выделяли методами накопительной культуры и прямого высева. Все культуры были протестированы на наличие амидазной активности. В результате предварительного отбора получено 45 клонов, имеющих амидазную активность выше 1,5 ЕД. Культуры, выделенные из образцов почв, а также штаммы лабораторной коллекции были исследованы на способность к стереоселектвиному гидролизу D,L-лактамида. В ходе работы было показано, что 45 штаммов гидролизовали лактамид без стереоселективности, 18 гидролизовали D-изомер лактамида и 10 - L-изомер.

В результате селекции были отобраны две культуры 4-1 и 6-1, гидролизующие D,L-лактамид с образованием D-молочной кислоты с максимальным энантиомерным избытком 44 и 43% соответственно (таблица 7).

___________________

Результаты получены лично.

–  –  –

3.2. ПЦР-анализ генов D-аминокислотных амидаз С помощью ПЦР анализа проведен скрининг последовательностей, гомологичных генам D-аминокислотных амидаз почвенных изолятов.

Установлено, что у 13 штаммов грамположительных бактерий присутствовали фрагменты ДНК размером около 750 п.н., гомологичные генам D-амидаз, ранее обнаруженных у Brevibacterium iodinum TPU 5850 GenBank, AB233405.1 (рисунок 9, 10). Штаммы принадлежали к роду Rhodococcus и Microbacterium.

–  –  –

Высокоактивная культура 6-1 была отобрана для дальнейших исследований и идентифицирована как Arthrobacter sp. на основании культурально-морфологических и биохимических свойств (таблица 9). Для выявления цикла развития проводили последовательное микроскопическое наблюдение за культурой разного возраста (6-24-48-72 часа, 5-7 суток).

Установлено, что молодая культура, находящаяся в экспоненциальной фазе роста, представлена палочками неправильной формы, с V-образными булавовидными концами. В культуре, соответствующей стационарной фазе роста (72 часа), палочки распадаются на кокки, одиночные или в скоплениях (рисунок 11).

–  –  –

Также путем секвенирования последовательностей генов 16S рРНК было подтверждено, что грамположительный штамм 6-1, отнесенный к виду Arthrobacter sp. на 98% соответствует гену 16S рРНК Arthrobacter sp. FB24 из базы данных GenBank.

3.4. Влияние источника углерода на рост и амидазную активность бактерий Оптимизация условий культивирования позволяет не только увеличить скорость роста и выход биомассы биотехнологически значимого штамма, но и повысить его продуктивность в отношении желаемых субстратов. При этом важную роль играют такие компоненты среды как источник углерода и азота.

Оценивали влияние различных источников углерода (глюкоза, сахароза, лактоза, мальтоза, сорбит, маннит, дульцит, инозит, янтарная, муравьиная, уксусная, лимонная кислоты) на рост и амидазную активность клеток R. rhodochrous 4-1 и Arthrobacter sp. 6-1. Исследуемые источники углерода вносили в минеральную среду в концентрации 0,1%, в качестве источника азота использовали 10 мМ ацетонитрил.

–  –  –

Рисунок 12 – Оптическая плотность культуры (ОП540) при культивировании R. rhodochrous 4-1 и Arthrobacter sp. 6-1 в присутствии различных источников углерода: 1 - глюкоза; 2 - сорбит; 3 - дульцит; 4 - инозит;

5 - маннит; 6 - мальтоза; 7 - лактоза; 8 - сахароза; 9 - уксусная кислота;

10 - лимонная кислота; 11 - муравьиная кислота; 12 - янтарная кислота.

Высокая плотность культуры R. rhodochrous достигалась в результате использования в качестве источника углерода ряда спиртов – сорбита, дульцита и инозита, а также янтарной кислоты. Максимальный рост штамма Arthrobacter sp. 6-1 наблюдался в присутствии сахарозы и ряда кислот – уксусной, лимонной и янтарной (рисунок 12). Указанная плотность соответствует максимальной и наблюдается в конце экспоненциальной фазы роста культур (3-4 сутки).

–  –  –

Рисунок 13 – Удельная активность амидазы R. rhodochrous 4-1 и Arthrobacter sp. 6-1, рассчитанная по трансформации акриловой кислоты, при росте на разных источниках углерода (активность при росте на глюкозе принята за 100 %): 1 - глюкоза; 2 - сорбит; 3 - дульцит; 4 - инозит; 5 - маннит; 6 мальтоза; 7 - лактоза; 8 - сахароза; 9 - уксусная кислота; 10 - лимонная кислота; 11 - муравьиная кислота; 12 - янтарная кислота.

Установлено, что штамм R. rhodochrous 4-1 проявляет максимальную амидазную активность при использовании сорбита в качестве источника углерода. Высокую активность амидазы штамма 4-1 также наблюдали при росте клеток на инозите и муравьиной кислоте. Оптимальными субстратами для роста и проявления амидазной активности Arthrobacter sp. 6-1 являются кислоты (лимонная, муравьиная и янтарная). Максимальная активность была зарегистрирована при росте клеток на муравьиной кислоте (рисунок 13).

3.5. Влияние источника азота на рост и амидазную активность бактерий Исследовано влияние ряда альтернативных источников азота на рост и амидазную активность штаммов R. rhodochrous 4-1 и Arthrobacter sp. 6-1.

–  –  –

Рисунок 14 – Оптическая плотность культуры (ОП540) при культивировании R. rhodochrous 4-1 и Arthrobacter sp. 6-1 в присутствии различных источников азота: 1 – хлорид аммония; 2 – нитрат натрия;

3 – нитрат калия; 4 – нитрат аммония; 5 – фосфат аммония;

6 – сульфат аммония; 7 - ацетонитрил; 8 – мочевина.

Максимальный рост клеток R. rhodochrous 4-1 и Arthrobacter sp. 6-1 наблюдался в присутствии ацетонитрила, который обеспечивал достаточно высокий уровень ферментативной активности (рисунок 14). Повышение амидазной активности культуры 4-1 наблюдалось также в присутствии мочевины (рисунок 15).

–  –  –

Известно, что многие оптически активные вещества обладают лишь ограниченной устойчивостью. В случае снижения доли одного из оптических изомеров при трансформации иммобилизованными на углеродном носителе клетками, возможно, происходит рацемизация молочной кислоты. Известно, что рацемизация чаще может происходить не самопроизвольно, а вызываться различными физико-химическими воздействиями, причем катализаторами рацемизации могут выступать щелочные агенты (Потапов, 1988). В данном случае, скорее всего, причиной снижения оптической чистоты образующегося раствора молочной кислоты при гидролизе адгезированными клетками является не изменение скорости образования изомеров, а присутствие носителя в образце, приводящее к рацемизации.

Таким образом, установлено, что оптимальными источниками углерода и азота для роста и проявления амидазной активности штамма R. rhodochrous 4-1 являлись дульцит и ацетонитрил, для штамма Arthrobacter sp. 6-1 муравьиная кислота и ацетонитрил. Стереоселективность, проявленная штаммами на этих питательных средах, незначительно отличалась от стереоселективности культур при росте на контрольной среде, а иммобилизация клеток на углеродном адсорбенте БАУ приводила к снижению оптической чистоты образующегося продукта.

ГЛАВА 4. СТЕРЕОСЕЛЕКТИВНЫЕ СВОЙСТВА ФЕРМЕНТНЫХ

ПРЕПАРАТОВ АМИДАЗ R. rhodochrous 4-1 и Arthrobacter sp. 6-1

4.1. Каталитические свойства амидазы, иммобилизованной методом ковалентной сшивки с хитозаном, активированным бензохиноном2 Амидазы штаммов R. rhodochrous 4-1 и Arthrobacter sp. 6-1 были иммобилизованы различными методами – методом ковалентной сшивки с хитозаном, методом адсорбции и методом поперечно сшитых агрегатов.

Установлено, что фермент R. rhodochrous, ковалентно иммобилизованный на хитозане, сохраняет 50-60% исходной активности при гидролизе акриламида и проявляет большую термостабильность по сравнению со свободным.

Иммобилизованный фермент Arthrobacter sp. 6-1 не проявлял высокой активности по отношению к акриламиду.

Показано, что при иммобилизации амидазы на активированном хитозане ее активность снижалась в 2 раза (рисунок 16).

_________________________

Экспериментальные работы по иммобилизации штамма R. rhodochrous 4-1 выполнены совместно с с.н.с. ЛММБ ИЭГМ УрО РАН к.б.н. Максимовой Ю.Г.

Рисунок 16 - Зависимость активности свободного (1) и иммобилизованного (2) ферментного препарата R. rhodochrous 4-1 от концентрации субстрата.

При увеличении концентрации субстрата - акриламида до 0,05 М наблюдалось линейное возрастание активности как иммобилизованного, так и свободного фермента, тогда как дальнейшее повышение концентрации субстрата не приводило к увеличению активности. Следовательно, данная концентрация субстрата для амидазы являлась насыщающей вне зависимости от связанного или свободного состояния фермента.

На графике зависимости скорости реакции, катализируемой иммобилизованной амидазой, от концентрации субстрата в двойных обратных координатах Лайнуивера-Берка наблюдается четко выраженный излом, свидетельствующий о том, что при концентрации субстрата выше 0,02 М (прямая 1) реакция протекает в кинетическом, ниже 0,02 М (прямая 2) – в диффузионном режиме (рисунок 17).

–  –  –

Рисунок 17 – Зависимость скорости реакции, катализируемой иммобилизованной амидазой R. rhodochrous 4-1, от концентрации субстрата.

Полученная зависимость является доказательством того, что диффузия играет в этом процессе важную роль (Березин и др., 1987).

Изучена операционная стабильность амидазы, ковалентно присоединенной к активированному хитозану. При проведении последовательных циклов конверсии акриламида установлено, что иммобилизованный ферментный препарат сохраняет около 20% активности, измеренной в первом цикле, после 5-кратной трансформации (рисунок 18).

2,5

–  –  –

1,5 Рисунок 18 – Операционная стабильность иммобилизованной амидазы R. rhodochrous 4-1.

За 144 ч при последовательной конверсии 0,05 М раствора акриламида 0,84 мг фермента катализировали образование 32 мг акриловой кислоты.

Изучена зависимость амидазной активности штамма R. rhodochrous 4-1 от температуры. Определено, что для фермента в растворе температурный оптимум трансформации акриламида находился в пределах 40С, для иммобилизованного – 55С (рисунок 19).

Активность,% о C Рисунок 19 – Зависимость каталитической активности свободной (1) и иммобилизованной (2) амидазы R. rhodochrous 4-1 от температуры.

Для исследования термической инактивации свободной и иммобилизованной амидазы проводили определение остаточной активности фермента при температурах 50–70°С (рисунки 20-22).

Активность,% Рисунок 20 – Термостабильность свободной (1) и иммобилизованной (2) амидазы R. rhodochrous 4-1 – воздействие температуры 50°С.

Активность,% Рисунок 22 – Термостабильность свободной (1) и иммобилизованной (2) амидазы R. rhodochrous 4-1 – воздействие температуры 70°С.

Обнаружено, что остаточная активность иммобилизованного фермента при 60°С после 60 минут инкубации составила 87% от начальной.

Нагревание фермента при 70°С в течение 30 минут приводило к неполной инактивации иммобилизованного фермента: он сохранял 14% каталитической активности. Было показано, что при воздействии повышенной температуры иммобилизованный фермент более стабилен, чем находящийся в растворе: константы скорости инактивации для иммобилизованного препарата амидазы при любой температуре будут ниже, чем для свободного фермента. Значения констант скорости термической инактивации свободной и ковалентно иммобилизованной амидазы представлены в таблице 12.

Таблица 12 - Термоинактивация свободной и иммобилизованной амидазы R. rhodochrous 4-1

–  –  –

Таким образом, ковалентная сшивка амидазы с носителем приводит к стабилизации ее структуры, предотвращая диссоциацию на субъединицы при повышении температуры, что приводит к повышению термостабильности иммобилизованного фермента.

Изучено сохранение активности иммобилизованного биокатализатора на основе амидазы, ковалентно присоединенной к активированному хитозану, в полностью дегидратированном состоянии. Так, при высушивании гранул хитозана иммобилизованный фермент сохранял 60% исходной активности, что подтверждает возможность длительного хранения высушенного иммобилизованного ферментного препарата.

4.2. Стереоселективные свойства амидаз, иммобилизованных различными методами Изучали стереоселективные свойства иммобилизованных амидаз R.

rhodochrous 4–1 и Arthrobacter sp. 6-1 в модельной реакции гидролиза рацемического лактамида до D- и L-изомеров молочной кислоты.

Отмечено, что при ковалентной сшивке ферментов обоих штаммов с активированным хитозаном стереоселективность реакции снижается (таблица 13, 14). Так, соотношение D- и L-энантиомеров молочной кислоты в реакции, катализируемой ферментом 4-1 в растворе, составило 89 и 11%, тогда как в реакции, катализируемой ковалентно присоединенной к хитозану амидазой – 59 и 41%.

Было изучено влияние адсорбционной иммобилизации на углеродсодержащих носителях на активность и стереоселективность амидаз.

Установлено, что при адсорбции амидаза R. rhodochrous сохраняет лишь 15активности нативного фермента, а амидаза Arthrobacter sp. – 36-46%.

Показано, что фермент 4-1, иммобилизованный на СУМС, гидролизовал лактамид до D- и L-молочной кислоты с соотношением энантиомеров 60 к 40%, тогда как фермент, адсорбированный на Сибуните, гидролизовал лактамид без стереоселективности (таблица 13). Иммобилизованный фермент Arthrobacter sp., полученный методом адсорбции, также проявлял низкую стереоселективность (таблица 14). Можно предположить, что в этом случае стереоселективность реакции снижается как за счет изменения скорости образования энантиомеров, так и в результате влияния гетерогенной среды, в частности, свойств носителей, на рацемизацию полученных продуктов реакции гидролиза лактамида. При контакте смеси Dи L-изомеров молочной кислоты в соотношении 4 : 1 с СУМС в течение 1 ч при 22С происходило превращение смеси в L-изомер, с Сибунитом – в Dизомер. Так как эти данные не согласуются с результатами трансформации рацемического лактамида амидазой, адсорбированной на этих носителях, можно заключить, что на процесс снижения энантиоселективности реакции влияет не только микроокружение фермента, создаваемое углеродным носителем, но и особенности образования фермент-субстратного комплекса у адсорбированного фермента.

Были получены поперечно-сшитые ферментные агрегаты при высаливании сульфатом аммония с одновременной сшивкой бифункциональными реагентами – глутаровым альдегидом и бензохиноном.

Установлено, что при сшивании молекул амидазы 4-1 бензохиноном сохраняется около 9% исходной активности фермента, глутаровым альдегидом – около 30% активности. Было показано, что иммобилизованные амидазы штаммов, полученные данным методом, проявляют более высокую D-стереоселективность, чем ферментные препараты в растворе. Так, биокатализатор 4-1, полученный сшивкой глутаровым альдегидом, катализировал гидролиз D,L-лактамида с энантиомерным избытком Dизомера до 92%, а поперечно сшитые агрегаты амидазы Arthrobacter sp. 6-1 при использовании глутаральдегида и бензохинона – 84 и 95% соответственно (таблица 13, 14).

Таблица 13 – Влияние иммобилизации на активность и стереоселективные свойства амидазы R. rhodochrous 4-1

–  –  –

Рисунок 23 – Влияние иммобилизации на стереоселективные свойства амидаз штаммов R. rhodochrous 4-1 и Arthrobacter sp. 6-1: 1 – амидаза в растворе, 2 – адсорбция на сибуните, 3 – адсорбция на СУМСе, 4 – ковалентная сшивка с хитозаном, 5 – поперечная сшивка 0,1% глутаровым альдегидом, 6 – поперечная сшивка 0,1% бензохиноном.

4.3. Влияние температуры на стереоселективные свойства ферментных препаратов амидаз3 Изучено влияние температуры на стереоселективные свойства поперечно сшитых ферментных препаратов амидаз. Было показано, что образование изомеров молочной кислоты происходит в диапазоне температур от 30 до 60°С, проявление максимальной активности ферментов наблюдали при 60°С.

Максимальный энантиомерный избыток реакции (ее), равный 78%, наблюдался у поперечно сшитых агрегатов амидазы 4-1 при 40-60°С, тогда как у свободного фермента – при 40°С (рисунок 24).

_________________________

Результаты получены лично.

–  –  –

Рисунок 24 – Зависимость энантиомерного избытка (1) и активности (2) поперечно сшитых препаратов амидазы R. rhodochrous 4-1 от температуры.

Максимальный энантиомерный избыток у ПСФА амидазы 6-1, полученных сшивкой глутаровым альдегидом, достигал 83% при 60°С. При этом наблюдали совпадение максимума энантиоселективности с максимумом активности фермента (рисунок 25).

–  –  –

Рисунок 25 – Зависимость энантиомерного избытка (1) и активности (2) поперечно сшитых препаратов амидазы Arthrobacter sp. 6-1 от температуры.

Сдвиг максимума энантиоселективности поперечно сшитых агрегатов амидазы в сторону более высоких температур может объясняться стабилизацией определенной конформации амидазы, более предпочтительной для образования фермент-субстратного комплекса с Dизомером лактамида. Температура ниже 20°С и выше 60°С приводила к снижению энантиоселективности. Известно, что энантиоселективность является результатом разницы между свободной энергией активации энантиомеров, которая имеет энтальпический и энтропический компонент. В данном случае образование комплекса D-изомера с активным центром амидазы энтальпически выгодно, но энтропически не выгодно. Другим значимым параметром является температура рацемизации. В данном случае нагрев реакционной смеси до 70°С приводил к резкому снижению энантиоселективности даже в случае ферментов, стабилизированных за счет иммобилизации.

4.4. Влияние рН на стереоселективные свойства ферментных препаратов амидаз Исследовали влияние рН среды на активность и стереоселективность препаратов амидаз. Установлено, что стереоселективность обоих ферментов достигает максимума при рН 6.0 (рисунок 26, 27). Тогда как максимум активности (1,51 ЕД) наблюдается при рН 7.0 - Arthrobacter sp. 6-1 и рН 7.0R. rhodochrous 4-1 (2,01 и 2,32 ЕД соответственно).

–  –  –

0,8 40 0,4 20

–  –  –

Рисунок 27 – Влияние рН среды на энантиомерный избыток (1) и активность амидазы (2) Arthrobacter sp. 6-1.

Влияние рН на активность и стереоселективность ферментов связано с ионизацией функциональных групп аминокислотных остатков белка, обеспечивающих оптимальную конформацию активного центра фермента.

При закислении среды происходит протонирование свободных аминогрупп, что приводит к изменению конформации молекулы фермента и конформации активного центра. В данном случае снижение рН с 7.0 до 6.0, вероятно, вызвало увеличение сродства D-изомера лактамида к активному центру амидазы.

ГЛАВА 5. БИОТРАНСФОРМАЦИЯ АРОМАТИЧЕСКИХ АМИДОВ

АМИНОКИСЛОТ

5.1. Биотрансформация D,L-фенилглицинонитрила4 5.1.1. Скрининг микроорганизмов, способных к гидролизу D,Lфенилглицинонитрила Для получения культур, гидролизующих рацемический фенилглицинонитрил до фенилглицина, исследовали способность бактерий усваивать фенилглицинонитрил как единственный источник азота. Для выделения активных штаммов использовали лабораторную коллекцию из 30 нитрилутилизирующих штаммов и 45 изолятов из образцов почвы промышленных предприятий.

В результате экспериментов было выявлено, что среди штаммов, использующих фенилглицинонитрил в качестве источника азота, 9 штаммов были способны гидролизовать рацемический субстрат с образованием Dизомера, 13 – с образованием L-изомера и 53 штамма не проявляли стереоселективности (таблица 15).

________________________

Результаты получены лично.

Таблица 15 – Гидролиз D,L-фенилглицинонитрила разными штаммами бактерий

–  –  –

5.1.2. Индукция нитрилгидролизующей активности штамма Rhodococcus rhodochrous 4-1 Для повышения скорости и эффективности гидролиза D,Lфенилглицинонитрила проводили эксперименты по оптимизации условий роста R. rhodochrous 4-1. Клетки выращивали в колбах Эрленмейера на синтетической среде N, с 0,1 % глюкозой и различными нитрилами в качестве индукторов в концентрации 0,1%. После 48 часов инкубации измеряли оптическую плотность, амидазную и нитрилгидратазную активность клеток. Затем проводили трансформацию 50 мМ D,Lфенилглицинонитрила.

В результате данного эксперимента было выявлено, что увеличение нитрилгидролизующей активности клеток вызывали все использованные нитрилы (рисунок 29). Клетки, индуцированные 0,1% бензонитрилом, показали максимальную активность по отношению к D,Lфенилглицинонитрилу.

–  –  –

Рисунок 29 – Индукция нитрилгидролизующей активности клеток R. rhodochrous 4-1 разными нитрилами.

Для определения влияния концентрации индуктора на активность были использованы разные концентрации бензонитрила – 0,025, 0,05 и 0,1%.

Клетки, индуцированные 0,05% бензонитрилом, гидролизовали L-изомер D,L-фенилглицинонитрила с максимальной скоростью (1,5 мкмоль/мг/мин) и энантиомерным избытком (68%). Повышение концентрации индуктора до 0,1% приводило к снижению скорости и степени конверсии. Вероятно, в более высокой концентрации индуктор оказывал токсичный эффект на бактериальные клетки.

5.1.3. Трансформация D,L-фенилглицинонитрила изолированной амидазой R. rhodochrous 4-1 Дальнейшие исследования по трансформации рацемического фенилглицинонитрила проводили с использованием изолированных нитрилгидролизующих ферментов – нитрилгидратазы и амидазы. Изучали влияние концентрации субстрата на активность и стереоселективность Lспецифичной амидазы (рисунок 30).

–  –  –

Рисунок 30 – Влияние концентрации D,L-фенилглицинонитрила на энантиомерный избыток (1) и активность (2) амидазы R. rhodochrous 4-1.

Было показано, что высокие концентрации субстрата значительно снижали энантиомерный избыток реакции и увеличивали активность амидазы. Максимальный энантиомерный избыток (93,6%) наблюдали при концентрации фенилглицинонитрила 10 мМ.

5.1.4. Влияние температуры на активность и стереоселективность амидазы 4-1 в реакции гидролиза D,LR. rhodochrous фенилглицинонитрила

–  –  –

В результате экспериментов было показано, что биоконверсия 10 мМ D,L-фенилглицинонитрила при температуре 10°С поперечно сшитыми агрегатами амидазы ведет к получению L-фенилглицина с выходом 48% и энантиомерным избытком 98%.

5.2. Биотрансформация L-фенилаланинамида5 Поиск микроорганизмов, обладающих L-специфической амидазной активностью по отношению к L-фенилаланинамиду осуществляли среди новых выделенных штаммов и нитрилгидролизующих штаммов лабораторной коллекции.

Методом тонкослойной хроматографии был проведен качественный анализ продуктов трансформации L-фенилаланинамида. Установлено, что гидролиз фенилаланинамида до аминокислоты фенилаланина осуществляют 16 штаммов (рисунок 33, 34, 35).

–  –  –

Фенилаланинамид Рисунок 34 – Разделение продуктов биотрансформации L-фенилаланинамида методом ТСХ: А-фенилаланинамид, К-фенилаланин.

На следующем этапе скрининга была проведена количественная оценка гидролазной активности микроорганизмов. Установлено, что максимальную активность по отношению к фенилаланинамиду проявляет штамм R.

erythropolis 6-2 1 (рисунок 36).

Рисунок 35 – Трансформация L-фенилаланинамида бактериальными штаммами.

В результате исследования температурной зависимости гидролиза, было показано, что максимальная скорость реакции наблюдалась при 50°С, что соответствует оптимальной температуре работы амидазы (таблица 17).

–  –  –

ЗАКЛЮЧЕНИЕ

Исследования энзиматического гидролиза нитрилов начались с 1980-х годов и касались, в основном, конверсий простых ахиральных нитрилов.

Интерес к стерео-, регио- и хемоселективности нитрилгидролизующих ферментов повысился относительно недавно – в начале 1990-х гг.

(Martinkova, Kren, 2002).

Процессы стереоселективного гидролиза нитрилов до соответствующих карбоновых кислот часто осуществляются при совместном функционировании нитрилгидратазы и амидазы (Fournand, Arnaud, 2001).

Стереоспецифическая конверсия нитрилов целыми клетками описана в патентной литературе (Jallageas et al., 1994). Однако тщательный анализ выявляет, что стереоселективна именно амидаза (Gilligan et al., 1993).

Известны лишь единичные примеры стереоселективности нитрилгидратаз (Payne et al., 1997; Masutomo et al., 1995).

Проведен скрининг микроорганизмов, способных гидролизовать D,Lлактамид до D- и L-изомеров молочной кислоты. В результате селекции получены штаммы – продуценты амидаз R. rhodochrous 4-1 и Arthrobacter sp.

6-1, клетки которых обладали наибольшей D-стереоселективностью по отношению к рацемическому лактамиду.

Исследовано влияние различных факторов на стереоселективные свойства амидаз, как изолированных, так и функционирующих в клетке.

Установлено, что изолированные ферменты проявляют более высокую стереоселективность, чем амидазы, имеющие внутриклеточную локализацию. Вероятно, это связано с наличием клеточной мембраны, которая создает значительные препятствия для диффузии субстрата к ферменту, снижая его стереоселективные свойства. Кроме того, в клетках имеется несколько ферментов, способных трансформировать субстрат в продукты противоположной конфигурации. Например, было показано, что индукция нитрилазы Rhodococcus sp. CGMCC 0497, которая обладает противоположной стереоселективностью, ведет к снижению энантиоселективности амидазы того же штамма (Wu, 2002).

В экспериментах было выявлено, что максимальная амидазная активность штамма R. rhodochrous 4-1 проявляется при росте на среде с многоатомными спиртами – сорбитом, инозитом, дульцитом. Подобный эффект известен у штамма R. erythropolis MTCC 1526, максимальная амидазная активность которого проявлялась при использовании сорбитола в качестве источника углерода (Bhalchandra et al., 2009). Максимальная активность амидазы штамма Arthrobacter sp. 6-1 зарегистрирована при росте на муравьиной кислоте.

Ранее было показано, что присутствие амидов или нитрилов в среде культивирования вызывает индукцию амидазной активности (Hughes et al., 1998). Нами установлено, что ацетонитрил служит не только источником азота для роста клеток, но и индуктором амидаз штаммов R. rhodochrous 4-1 и Arthrobacter sp. 6-1. Так, уровень амидазной активности при росте клеток R. rhodochrous 4-1 на среде с ацетонитрилом был в 2,5 раза выше, чем в контроле.

Количество образующейся биомассы на средах с разными источниками углерода было различным. Наибольшее накопление бактериальных клеток наблюдалось при выращивании их на среде с маннитом, инозитом, лимонной и янтарной кислотами. Однако строгой корреляции между накоплением клеток в культуре и биосинтезом фермента установлено не было.

В литературе имеются работы, посвященные исследованию влияния условий культивирования бактерий на их энантиоселективные свойства (Yamamoto et al., 1990; Yamamoto et al., 1991; Wu, 2002). Путем оптимизации состава среды для роста культуры Rhodococcus sp. CGMCC 0497, удалось повысить не только амидазную активность по отношению к 2фенилпропионамиду, но и S-стереоселективность штамма (Wu, 2002).

В данной работе использование оптимальных источников углерода и азота для роста и проявления амидазной активности привело к незначительному повышению (на 2-15%) стереоселективных свойств обоих штаммов.

Для изучения влияния иммобилизации на стереоселективность амидаз клетки штаммов R. rhodochrous 4-1 и Arthrobacter sp. 6-1 адсорбировали на пористом углеродном адсорбенте БАУ. В результате экспериментов было выявлено не только значительное снижение амидазной активности, но и полная потеря стереоселективности ферментов. Вероятно, снижение доли одного из оптических изомеров при трансформации иммобилизованными на углеродном носителе клетками вызвано присутствием носителя в образце, приводящее к рацемизации молочной кислоты.

Получены препараты амидазы R. rhodochrous 4–1, иммобилизованной методом ковалентной сшивки с хитозаном. Проведен сравнительный анализ некоторых каталитических свойств свободной и иммобилизованной на активированном хитозане амидазы. Показано, что иммобилизованный фермент сохраняет 50–60% исходной активности, проявляет большую термостабильность по сравнению с амидазой в растворе и сохраняет более 20% активности на протяжении пяти 24-часовых циклов трансформации акриламида. Установлено, что при иммобилизации методом ковалентной сшивки с хитозаном амидаза не теряет своих D-стереоспецифических свойств и катализирует гидролиз рацемического лактамида с энантиомерным избытком 31,6%.

Были получены поперечно-сшитые агрегаты ферментов при высаливании сульфатом аммония с одновременной сшивкой бифункциональными реагентами - глутаровым альдегидом и бензохиноном.

Метод поперечно-сшитых ферментных агрегатов в настоящее время является широко распространенным методом иммобилизации ферментов. Уже продемонстрировано успешное применение пероксидаз (Sulek et al., 2011), липаз (Wilson et al., 2006; Hara et al., 2008), нитрилаз (Kumar et al., 2010) и эстераз (Park et al., 2010), иммобилизованных поперечной сшивкой. Так, иммобилизация методом ПСФА оксинитрилазы позволила не только повысить стабильность фермента, но и увеличить выход реакции и оптическую чистоту получаемого продукта (ее увеличился с 91% до 95%) (Groger et al., 2001). Поперечно сшитые агрегаты амидазы R. erythropolis были успешно применены в энантиоселективном гидролизе 4-хлор-3гидроксибутиронитрила до соответствующей кислоты. Свободный фермент катализировал конверсию R-изомера с выходом 57% и энантиомерным избытком 52%. Благодаря использованию ПСФА выход реакции был увеличен до 85% с оптической чистотой 93% (Park et al., 2010).

Нами было показано, что иммобилизация амидаз методом поперечно сшитых ферментных агрегатов позволила увеличить стереоселективность трансформации D,L-лактамида с 78 до 92% для R. rhodochrous 4-1 и с 64 до 84% для Arthrobacter sp. 6-1 по сравнению с гидролизом лактамида ферментом в растворе. При этом сохранялось около 30% исходной активности ферментов в случае сшивки глутаровым альдегидом и 9-28% - в случае использования бензохинона.

Установлено, что стереоселективность амидаз является температурнозависимой. Образование изомеров молочной кислоты происходило в диапазоне 30-60°С, при этом максимальная активность амидаз наблюдалась при 50-60°С. Температура ниже 20°С и выше 60°С приводила к снижению энантиоселективности обоих ферментов. Очевидно, что важную роль в этом процессе играет температура рацемизации (Kaul et al., 2007).

Согласно теории переходного состояния, энантиоселективность является результатом разницы между свободной энергией активации энантиомеров, которая имеет энтальпический и энтропический компонент. В данном случае энтальпия и энтропия благоприятствуют образованию комплекса D-изомера с активным центром амидазы.

В ходе работы было показано, что энантиоселективность амидаз увеличивается в слабокислой среде и максимальна при рН среды, равной 6.0.

Подобное явление было описано в литературе для нитрилазы, катализирующей стереоселективный гидролиз D,L-фенилглицинонитрила до D-изомера фенилглицина (Wang et al., 2001).

Проведены эксперименты по биотрансформации D,Lфенилглицинонитрила. Подобраны оптимальные условия гидролиза рацемического субстрата, которые соответствуют низкой скорости спонтанного (неферментативного) гидролиза с одновременной высокой активностью и стереоселективностью биокатализатора. В результате биоконверсии 10 мМ D,L-фенилглицинонитрила поперечно сшитыми агрегатами амидазы R. rhodochrous 4-1 был получен L-фенилглицин с выходом 48% и энантиомерным избытком 98%.

Опубликованные ранее данные сообщали о биоконверсии 5 мМ Dфенилглицинонитрила иммобилизованными клетками Rhodococcus sp. NOVO SP 361, которая приводила к получению 94% D-фенилглицина с энантиомерным избытком 92%. При увеличении концентрации субстрата до 100 мМ, наблюдался его быстрый распад, и D-фенилглицин был получен с выходом всего 37% (Wegman et al., 2000).

По данным литературы, максимальный выход D-фенилглицина (96%) с энантиомерным избытком 95% наблюдали при 5°С (Wegman et al., 2000).

Вероятно, низкая температура стабилизирует субстрат, склонный к спонтанной деградации и рацемизации.

Отмечено, что по отношению к D,L-лактамиду амидаза R. rhodochrous 4-1 проявляла D-стереоселективность, тогда как гидролиз D,Lфенилглицинонитрила проходил с образованием L-изомера. Подобное явление, наблюдаемое при стереоселективной трансформации субстратов другими ферментами, в научной литературе было обозначено термином «инверсия стереоселективности». В зависимости от структуры субстрата липазы Rhizomucor miehei и Humicola lanuginose проявляли разную энантиоселективность к эфирам 2-метилдекановой кислоты (Holmquist et al., 1993). D-пептидаза Actinomadura R39 проявляла строгую D-специфичность к ди- и трипептидам, а также гидролизовала тиоловые эфиры, чьи Стерминальные группы находились в L-конфигурации (Damblon et al., 1995).

Методом тонкослойной хроматографии проведен качественный анализ продуктов трансформации L-фенилаланинамида. Выявлено 16 штаммов, способных к гидролизу субстрата до аминокислоты.

Штамм R. erythropolis 6-2 1 трансформировал фенилаланинамид с максимальной амидазной активностью 6,2 мкмоль/мг/мин при 50°С.

Таким образом, изучены основные факторы, влияющие на стереоселективность амидаз, разработан эффективный метод получения гетерогенного биокатализатора, позволяющий увеличивать энантиомерную чистоту продукта реакции, показана возможность биотехнологического применения поперечно сшитых агрегатов амидазы в энзиматическом синтезе аминокислот.

ВЫВОДЫ

1. В процессе селекции получены штаммы – продуценты амидаз R. rhodochrous 4-1 и Arthrobacter sp. 6-1, способные к стереоселективной трансформации D,L-лактамида с максимальным энантиомерным избытком 44 и 43% соответственно.

2. Установлено, что оптимальными источниками углерода и азота для роста и проявляения амидазной активности R. rhodochrous 4-1 являются дульцит и ацетонитрил, Arthrobacter sp. 6-1 – муравьиная кислота и ацетонитрил соответственно. Показано, что оптимизированная среда не влияет на стереоселективные свойства штаммов по отношению к D,L-лактамиду.

3. Иммобилизация амидазы 4-1 методом R. rhodochrous ковалентной сшивки с 0,1% хитозаном привела к повышению термо- и операционной стабильности фермента. Показана возможность длительного хранения высушенного иммобилизованного ферментного препарата.

4. Образование поперечно сшитых агрегатов амидаз позволило увеличить стереоселективность трансформации D,L-лактамида с 78 до 92% для фермента из R. rhodochrous 4-1 и с 64 до 84% для фермента из Arthrobacter sp. 6-1 по сравнению с их нативной формой.

5. Определено, что максимальный энантиомерный избыток реакции трансформации D,L-лактамида наблюдается при рН 6.0 и температуре 40-60°С.

6. Установлено, что оптимальными условиями для биотрансформации D,L-фенилглицинонитрила являются температура реакции 10°С, концентрация субстрата 10 мМ, а наиболее эффективным биокатализатором этого процесса – поперечно сшитые ферментные агрегаты амидазы R. rhodochrous 4-1.

СПИСОК ЛИТЕРАТУРЫ

1. Беликов, В. М. Аминокислоты для сельского хозяйства, пищевой промышленности и здравоохранения / В. М. Беликов, В. Г. Дебабов, Н.

Я. Тюряев // Вестник АН СССР. – 1980. № 4. – С. 18-25.

2. Березин, И. В. Иммобилизованные ферменты. Современное состояние и перспективы / И. В. Березин, В. К. Антонов, К. Мартинек. – Москва:

МГУ, 1976. – т. 2. – 137 с.

3. Дебабов, В. Г. Биокаталитический гидролиз нитрилов / В. Г. Дебабов, А. С. Яненко // Обзорный журнал по химии. – 2011. – № 4. – С. 376Коваленко, Г. А. Каталитичсекие свойства глюкоамилазы, иммобилизованной на углеродном носителе Сибунит / Г. А. Коваленко, Л. В. Перминова, Т. Г. Терентьева, Г. В. Плаксин // Прикладная биохимия и микробиология. – 2007. – Т. 43. – № 4. – С. 412-418.

5. Кузнецова, М. В. Физиолого-биохимическая характеристика штаммов рода Rhodococcus - продуцентов нитрилгидратазы: дисс. … канд. биол.

наук: 03.00.07 / Кузнецова Марина Валентиновна. – П., 2004. – 123 с.

6. Лавров, К.В. Новая ациламидаза из Rhodococcus erythropolis ТА37, способная гидролизовать N-замещенные амиды / К.В. Лавров, И.А.

Залунин, Е.К. Котлова, А.С. Яненко // Биохимия. – 2010. – T. 75. – Вып.

8. – C. 1111-1119.

7. Лакин, Г.Ф. Биометрия / Г.Ф. Лакин. – Москва: Высшая школа, 1990. – 352 с.

8. Максимов, А. Ю. Влияние нитрилов и амидов на рост и нитрилгидратазную активность штамма Rhodococcus sp. gt1 / А. Ю.

Максимов и др. // Прикладная биохимия и микробиология. – 2003. – № 1. – С. 63-68.

9. Перцович, С.И. Алифатическая амидаза Rhodococcus rhodochrous – представитель семейства нитрилаз/цианидгидратаз / С.И. Перцович, Д.Т. Гуранда, Д.А. Подчерняев [и др.] // Биохимия. – 2005. – Т. – 70. – № 11. – С. 1556-1565.

10. Потапов, В. М. Стереохимия / В. М. Потапов // Москва: Химия, 1988. – 464 с.

11. Сафонова, Э. Н. Успехи в области синтеза и производства аминокислот / Э. Н. Сафонова, В. М. Беликов // Успехи химии. – 1974.

– № 9. – С. 1575-1609.

12. Тишков, В. И. Современные тенденции развития процессов биокаталитического синтеза хиральных соединений / В. И. Тишков, Е.

А. Зайцева // Вестник Московского Университета. – 2008. – Т.49. – № 2.

– С. 138-141.

13. Халиуллин, И. Г. Биоинформатический анализ и молекулярное моделирование участия Lys65 в каталитической триаде Dаминопептидазы из Ochrobactrum anthropi / И. Г. Халиуллин, Д. А.

Суплатов, Д. Н. Шалаева, М. Оцука, Я. Асано, В. К. Швядас // Acta naturae. – 2010. – № 2. – С. 70-74.

14. Хоулт Д. Определитель бактерий Берджи / Д. Хоулт // Москва: Мир, 1997. – Т. 1, 2.

15. Швядас, В. К. Ферментативное превращение рацематов в энантиомеры аминокислот / В. К. Швядас, И. Ю. Галаев // Успехи химии. – 1983. – № 12. – С. 2039-2071.

16. Шпак, В. С. Пути получения и использования синтетических аминокислот / В. С. Шпак, И. Я. Тюряев // Вестник АН СССР. – 1983.

№ 2. С. 107.

17. Якубке, Х.-Д. Аминокислоты. Пептиды. Белки / Х.-Д. Якубке, Х. М.

Ешкайт. – Москва: Мир, 1985. – 82 с.

18. Alcalde, M. Environmental biocatalysis: from remediation with enzymes to novel green processes / M. Alcalde, M. Ferrer, F. Plou, A. Ballesteros // Trends in Biotechnology. – 2006. – V. 24. – P. 281-287.

19. Alonso, F. Enantiomerically pure D-phenylglycine production using immobilized Pseudomonas aeruginosa 10145 in calcium alginate beads / F.

Alonso, O. Antunes, E. Oestreicher // Journal of the Brazilian Chemical Society. – 2007. – V. 18. – P. 566-572.

20. Alonso, F. Production of enantiomerically pure D-phenylglycine using Pseudomonas aeruginosa 10145 as biocatalyst / F. Alonso, E. Oestreicher, O. Antunes // Brazilian Journal of Chemical Engineering. – 2008. – V. 25.

– P. 1-8.

21. Arima, J. Bacillus D-stereospecific metallo-amidohydrolase: active-site metal-ion substitution changes substrate specificity / J. Arima, Y. Uesugi, T.

Hatanaka // Biochimie. – 2009. – V. 91. – P. 568-576.

22. Arnaud, A. Amidase activity of some bacteria / A. Arnaud, P. Galzy, J.

Jallageas // Folia Microbiologica. – 1976. – V. 21. – P. 178-184.

23. Asano, Y. A new D-stereospecific amino acid amidase from Ochrobactrum anthropi / Y. Asano, T. Mori, S. Hanamoto, Y. Kato, A. Nakazawa // Biochemical and Biophysical Research Communications. – 1989. – V. 162.

– P. 470-474.

24. Baek, D. Characterization of a thermostable D-stereospecific alanine amidase from Brevibacillus borstelensis BCS-1 / D. Baek, S.-J. Kwon, S.-P.

Hong, M.-S. Kwak, M.-H. Lee, J. Song, S.-G. Lee, K.-H. Yoon, M.-H. Sung // Applied and Environmental Microbiology. – 2002. – V. 69. – P. 980-986.

25. Baek, D. New thermostable D-methionine amidase from Brevibacillus borstelensis BCS-1 and its application for d-phenylalanine production / D.

Baek, J. Song, S-G. Lee, S. Kwon, Y. Asano, M.-H. Sung // Enzyme and Microbial Technology. – 2003. – V. 32. – P. 131-139.

26. Bauer, R. Enantioselective hydrolysis of racemic 2-phenylpropionitrile and other (R,S)-2-arylpropionitriles by a new bacterial isolate Agrobacterium tumefaciens strain d3 / R. Bauer, B. Hirrlinger, N. Layh, A. Stolz, H. J.

Knackmuss // Applied Microbiology and Biotechnology. – 1994. – V. 42. – P.1-7.

27. Bercovici, D. Industrial amino acids in nonruminant animal nutrition / D.

Bercovici, F. Fuller // Biotechnology in Animal Feeds and Animal Feeding.

Chapter 6. – 1995.

– P. 93-113.

28. Bommarius, A. S. Synthesis and use of enantiomerically pure tert-leucine / A. S. Bommarius, M. Schwarm, K. Stingl, M. Kottenhahn, K. Huthmacher, K. Drauz // Tetrahedron Asymmetry. – 1995. – V. 6. – P. 2851-2888.

29. Bell, G. Biocatalyst behaviour in low-water systems / G. Bell, P. J. Halling, B. D. Moore, J. Partridge, D. G. Rees // Trends in biotechnology. –1995. – V. 13. – P. 468-473.

30. Bovara, R. Effects of water activity on Vmax and Km of lipase catalyzed transesterification in organic media / R. Bovara, G. Carrea, G. Ottolina, S.

Riva // Biotechnology Letters. – 1993. – V15. – P. 937-942.

31. Bovara, R. Water activity does not influence the enantioselectivity of lipase PS and lipoprotein lipase in organic solvents / R. Bovara, G. Carrea, G.

Ottolina, S. Riva // Biotechnology Letters. – 1993. – V. 15. – P. 169-174.

32. Bradford, M. M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding / M. M. Bradford // Analytical Biochemistry. – 1976. – V. 72. – P. 248–254.

33. Breuer, M. Industrial methods for the production of optically active intermediates / M. Breuer, K. Ditrich, T. Habicher, B. Hauer, M. Keeler, R.

Strmer, T. Zelinski // Angewandte Chemie International Edition. – 2004. – V. 43. – P. 788-824.

34. Broos, J. Flexibility of enzymes suspended in organic solvents probed by time-resolved fluorescence anisotropy. Evidence that enzyme activity and enantioselctivity are directly related to enzyme flexibility / J. Broos, A. J.

Visser, J. F. Engbersen, W. Verboom, A. Hoek, D. N. Reinhout // Journal of the American Chemical Society. – 1995. – V. 117. – P. 12657-12663.

35. Bruggink, A. Synthesis of -lactam antibiotics: chemistry, biocatalysis and process integration / A. Bruggink, P.D. Roy. – Dordrecht: Kluwer Academic Publishers, 2001. – 103 p.

36. Burteau, N. Stabilisation and immobilization of penicillin amidase / N.

Burteau, S. Burton, R. R. Crichton // FEBS Letters. – 1989. – V. 258. – P.

185-189.

37. Cai, G. Cloning, sequence analysis and expression of the gene encoding a novel wide-spectrum amidase belonging to the amidase signature superfamily from Achromobacter xylosoxidans / G. Cai, S. Zhu, X. Wang, W. Jiang // FEMS Microbiology Letters. – 2005. – V. 249. – P. 15-21.

38. Cantarella, M. Amidase-catalyzed production of nicotinic acid in batch and continuous stirred membrane reactors / M. Cantarella, L. Cantarella, A.

Gallifuoco, R. Intellini, O. Kaplan, A. Spera, L. Martnkov // Enzyme and Microbial Technology. – 2008. – V. 42. – P. 222-229.

39. Carrea, G. Effect of reaction conditions on the activity and enantioselectivity of lipases in organic solvents / G. Carrea, G. Ottolina, S.

Riva, F. Secundo // Biocatalysis in non conventional media. Progress in biotechnology. – 1992. – V. 8. – P. 111-119.

40. Cacaval, D. 6-Aminopenicillanic acid production in stationary basket bioreactor with packed bed of immobilized penicillin amidase-Penicillin G mass transfer and consumption rate under internal diffusion limitation / D.

Cacaval, M. Turnea, A.-I. Galaction, A. C. Blaga // Biochemical Engineering Journal. – 2012. – V. 69. – P. 113-122.

41. Chacko, S. A comparative study on the production of amidase using immobilized and dehydrated immobilized cells of Pseudomonas putida MTCC 6809 / S. Chacko, P. W. Ramteke, B. Joseph // Journal of Genetic Engineering and Biotechnology. – 2012. – V. 10. – P. 121-127.

42. Chand, D. Treatment of simulated wastewater containing toxic amides by immobilized Rhodococcus rhodochrous NHB-2 using a highly compact 5stage plug reactor / D. Chand, H. Kumar, U. D. Sankhian, D. Kumar, F.

Vitzthum, T. C. Bhalla // World Journal of Microbiology and Biotechnology. – 2004. – V. 7. – P. 679-686.

43. Chen, J. Microbial transformation of nitriles to high-value acids or amides / J. Chen, R.-C. Zheng, Y.-G. Zheng, Y.-C. Shen // Advances in Biochemical Engineering/Biotechnology. – 2009. – V. 113. – P. 33-77.

44. Chibata, I. Industrial application of immobilized enzyme system / I. Chibata // Pure and Applied Chemistry. - 1978. – V. 50. – P. 667-675.

45. Chibata, I. Production of L-amino acids by aminoacylase absorbed on DEAE-Sephadex / I. Chibata, T. Tosa, T. Sato, T. Mori // Methods in Enzymology. – 1976. – V. 44. – P. 746-759.

46. Choi, S.Y. Hydrolysis of the nitrile group in -aminophenylacetinitrile by nitrilase; development of a new biotechnology for stereospecific production of S--phenylglycine / S.Y. Choi, Y.M. Goo // Archives of Pharmacal Research. – 1986. – V. 9. – P. 45-47.

47. Colby, J. Immobilization of Rhodococcus AJ270 and use of entrapped biocatalyst for the production of acrylic acid / J. Colby, D. Snell, G. W.

Black // Chemical Monthly. – 2000. – V. 131. – P. 655-666.

48. Collet, A. Optical resolution by direct crystallization of enantiomer mixtures / A. Collet, M. J. Brienne, J. Jacques // Chemical Reviews. – 1980.

– V. 80. – P. 215-227.

49. Colombo, G. Application of structure-based thermodynamic calculations to the rationalization of the enantioselectivity of subtilisin in organic solvents / G. Colombo, G. Ottolina, G. Carrea // Tetrahedron: Asymmetry. – 1988. – V. 9. – P. 1205-1214.

50. Damblon, C. Thiolester substrates of DD-peptidases and beta-lactamases / C. Damblon, P. Ledent, G.-H. Zhao, M. Jamin, A. Dubus, M. Vanhove, X.

Raquet, L. Christiaens, J.-M. Frere // Letters in Peptide Science. – 1995. – V. 2. – P. 212-216.

51. Ducret, A. Lipase-catalyzed enantioselective esterification of ibuprofen in organic solvents under controlled water activity / A. Ducret, M. Trani, R.

Lortie // Enzyme and Microbial Technology. – 1998. – V. 22. – P. 212-216.



Pages:   || 2 |
Похожие работы:

«"ПЕДАГОГИКО-ПСИХОЛОГИЧЕСКИЕ И МЕДИКО-БИОЛОГИЧЕСКИЕ ПРОБЛЕМЫ ФИЗИЧЕСКОЙ КУЛЬТУРЫ И СПОРТА" Электронный журнал Камского государственного института физической культуры Рег.№ Эл №ФС77-27659 от 26 марта 2007г №2 (1/2007) УДК 616.711 СКОЛИОЗ В МЛАДШЕМ ШКОЛЬНОМ ВОЗРАСТЕ доктор...»

«1. Цели и задачи дисциплины Цель изучения дисциплины "Экология" обеспечение необходимого для успешного осуществления профессиональной деятельности уровня знаний в области экологии, биосферных процессов, теории эволюции, деят...»

«ФУНДАМЕНТАЛЬНОЕ ЯДРО СОДЕРЖАНИЯ ОБЩЕГО ОБРАЗОВАНИЯ Москва СОДЕРЖАНИЕ КОНЦЕПЦИЯ ФУНДАМЕНТАЛЬНОГО ЯДРА СОДЕРЖАНИЯ ОБЩЕГО ОБРАЗОВАНИЯ ФУНДАМЕНТАЛЬНОЕ ЯДРО СОДЕРЖАНИЯ ОБЩЕГО ОБРАЗОВАНИЯ БАЗОВЫЕ НАЦИОНАЛЬНЫЕ ЦЕННОСТИ ОСНОВНЫЕ ЭЛЕМЕНТЫ НАУЧНОГО ЗН...»

«Режим дня это рациональное распределение времени на все виды деятельность и отдыха в течение суток. Основной его целью служит обеспечить высокую работоспособность на протяжении всего периода бодрствования. Стр...»

«ПОЯСНИТЕЛЬНАЯ ЗАПИСКА Согласно действующему базисному учебному плану рабочая программа для 9 – го класса предусматривает обучение биологии в объеме 2 часов в недели и 68 часов за весь учебный год. Рабочая программа...»

«Р. Г. Ноздрачева Абрикос. Технология выращивания Серия "Библиотека журнала "Чернозёмочка"" http://www.litres.ru/pages/biblio_book/?art=8909258 Р. Г. Ноздрачёва. Абрикос. Биология и технология выращивания: ИД Социум; Воронеж; 2013 Ан...»

«2014 Географический вестник 4(31) Гидрология ГИДРОЛОГИЯ УДК 504:658.562 С.С.Дубняк © ЭКОЛОГО-ГИДРОМОРФОЛОГИЧЕСКОЕ ОБОСНОВАНИЕ БЕРЕГОЗАЩИТНЫХ ЭКОСИСТЕМ НА КРУПНЫХ РАВНИННЫХ ВОДОХРАНИЛИЩАХ Рассмотрены проблемы улучшения технического и экологического состояния крупных равнинных водохранилищ, важнейшей из которых...»

«МИНИСТЕРСТВО ОБРАЗОВАНИЯ И НАУКИ РОССИЙСКОЙ ФЕДЕРАЦИИ Кемеровский государственный университет Биологический факультет Рабочая программа дисциплины ГЕОГРАФИЯ КЕМЕРОВСКОЙ ОБЛАСТИ Направление подготовки 05.03.01 Геология Направленность (профиль) подготовки Геология Уровень бакалавриата Форма обучения Очная Кемерово 2016 СОДЕРЖА...»

«Научно-исследовательская работа Тема работы Воздействие микроволн на живые организмы.Выполнил: Тарасов Егор Александрович учащийся 7 класса Государственного бюджетного общеобразовательного учреждения средней общеобразовательной школы №...»

«Б А К А Л А В Р И А Т В.М. КРОЛЬ, М.В. ВИХА ПСИХОФИЗИОЛОГИЯ Рекомендовано УМО по классическому университетскому образованию в качестве учебного пособия для студентов высших учебных заведений, обучающихся по специальности ВПО 030301 "Психология" и на...»

«МИНИСТЕРСТВО ЗДРАВООХРАНЕНИЯ УКРАИНЫ ЗАПОРОЖСКИЙ ГОСУДАРСТВЕННЫЙ МЕДИЦИНСКИЙ УНИВЕРСИТЕТ КАФЕДРА ФИЗИЧЕСКОЙ И КОЛЛОИДНОЙ ХИМИИ МЕТОДИЧЕСКИЕ УКАЗАНИЯ К ПРАКТИЧЕСКИМ ЗАНЯТИЯМ И ВЫПОЛНЕНИЮ ЛАБОРАТОРНЫХ РАБОТ ПО МЕДИЦИНСКОЙ ХИМИИ ДЛЯ СТУДЕНТ...»

«ПЛОТНИКОВ Вадим Алексеевич МОЛЕКУЛЯРНО-ГЕНЕТИЧЕСКИЙ АНАЛИЗ И БИОЛОГИЧЕСКАЯ ХАРАКТЕРИСТИКА ПОЛЕВЫХ ИЗОЛЯТОВ ВИРУСА ЛЕЙКОЗА ПТИЦ, ЦИРКУЛИРУЮЩИХ НА ТЕРРИТОРИИ РОССИЙСКОЙ ФЕДЕРАЦИИ 03.02.02 – вирусология АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологиче...»

«ГЕОФИЗИЧЕСКИЕ ПРОЦЕССЫ И БИОСФЕРА, 2012, T. 11, № 2, с. 16–39 УДК 577.35 : 75.033 : 537.868 : 573.22 ИНТЕРФЕРЕНЦИЯ МЕХАНИЗМОВ ВЛИЯНИЯ СЛАБЫХ ЭЛЕКТРОМАГНИТНЫХ ПОЛЕЙ КРАЙНЕ НИЗКИХ ЧАСТОТ НА ОРГАНИЗМ ЧЕЛОВЕКА И ЖИВОТНЫХ © 2012 г. В.С. Мартынюк1, Ю.В. Цейслер1, Н.А. Темурьянц2 Киев...»

«Известия Пермского Биологического Научно-Исследовательского Института Том IX. Вът. 1—3. Основные черты эволюции растительности долин некоторых рек Западного Предуралья 1). В. А. В а х р у ш е в а, А. А. Г е н к е ль, М. М. Д а н и л...»

«МИНИСТЕРСТВО СЕЛЬСКОГО ХОЗЯЙСТВА РОССИЙСКОЙ ФЕДЕРАЦИИ Федеральное государственное образовательное учреждение высшего профессионального образования "КУБАНСКИЙ ГОСУДАРСТВЕННЫЙ АГРАРНЫЙ УНИВЕРСИТ...»

«1 ХИМИЯ. БИОЛОГИЯ. МЕДИЦИНА 1. Biomediale : соврем. общество и геномная культура / ред.-сост. Д. Булатов. Е0 Калининград : Янтарный сказ, 2004. 499 с. : ил.; 27 см. Библиогр. : с. 488-493 B60 Экземпляры: всего:2 ЧЗ(1), БФ(1) 2. Байков, Константин Станиславович. Е5 Молочаи Северной Азии / К. С. Байков. Новосибирск : Наука,...»

«Биологический возраст и старение – современные методы оценки Эмануэль В.Л.Эссе на актуальную тему по результатам встреч с коллегами: Титовым В.Н., Тогузовым Р.Т., Кушкуном А.А., Вельковым В.В., Одиным В.И. Средняя продолжительность жизни в развиты...»

«РЕЗЮМЕ ПРОЕКТА Группа компаний Борец Название проекта: Россия Страна: № проекта: Промышленность Отрасль: Частный сектор Государственный/ частный сектор: B Экологическая категория: 21 октября 2009 года Дата...»

«Т. И. Свистунова СТРУКТУРА МЕНТАЛЬНОГО ЛЕКСИКОНА ПРИ НАРУШЕНИЯХ ЯЗЫКОВОЙ СИСТЕМЫ: ЭКСПЕРИМЕНТАЛЬНОЕ ИССЛЕДОВАНИЕ ГЛАГОЛЬНОЙ СЛОВОИЗМЕНИТЕЛЬНОЙ МОРФОЛОГИИ 1 Работа представлена кафедрой общего...»

«УДК 504:330(075.8) К.П. Колотырин ЭКОНОМИЧЕСКИЕ ИНСТРУМЕНТЫ СТИМУЛИРОВАНИЯ ПРИРОДООХРАННОЙ ДЕЯТЕЛЬНОСТИ Рассматриваются проблемы эффективного финансирования природоохранных программ, обосновывается...»

«ВОЗБУЖДЕНИЕ БАББЛОВ И БРИЗЕРОВ В ДНК И ИХ ВЗАИМОДЕЙСТВИЕ С НОСИТЕЛЯМИ ЗАРЯДА УДК: 2013.12.27 Возбуждение бабблов и бризеров в ДНК и их взаимодействие с носителями заряда *1 **2 ©2014 Лахно В.Д., Четвериков А.П. Институт математических проблем...»

«Бюллетень Никитского ботанического сада. 2011. Вып. 100 ОТ МЕТОДОВ ЗАЩИТЫ К ТЕОРИИ ПРОТИВОЭПИДЕМИЧЕСКОГО УПРАВЛЕНИЯ (Итоги работы сектора энтомологии и фитопатологии НБС-ННЦ за 2000-2009 гг.) Е. Б. БАЛЫКИНА, кандидат биологических наук; Н. Н. ТРИКОЗ, кандидат биологически...»

«1. Цели освоения дисциплины Целью освоения дисциплины "Инновационные технологии в агрономии" является формирование у студентов навыков по совершенствованию технологий возделывания сельскохозяйственных культур в соо...»

«Экосистемы, их оптимизация и охрана. 2012. Вып. 7. С. 98–113. Биоценология и биология видов УДК 574.5/.6:612.176 ОТКЛИК ГИДРОБИОНТОВ НА СТРЕССОВЫЕ ФАКТОРЫ МОРСКИХ ЭКОCИСТЕМ Шахматова О. А. Институт биологии южных морей им. А. О. Ковалевского НАН Украины, Севастополь, oshakh@gma...»








 
2017 www.lib.knigi-x.ru - «Бесплатная электронная библиотека - электронные матриалы»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.